Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APPL2 cdna clone

APPL2 cDNA Clone

Gene Names
APPL2; DIP13B
Synonyms
APPL2; APPL2 cDNA Clone; APPL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccgccgtggacaagctcctgctagaggaggcgttgcaggacagcccccagactcgctctttactgagcgtgtttgaagaagatgctggcaccctcacagactataccaaccagctgctccaggcaatgcagcgcgtctatggagcccagaatgagatgtgcctggccacacaacagctttctaagcaactgctggcatatgaaaaacagaactttgctcttggcaaaggtgatgaagaagtaatttcaacactccactatttttccaaagtggtggatgagcttaatcttctccatacagagctggctaaacagttggcagacacaatggttctacctatcatacaattccgagaaaaggatctcacagaagtaagcactttaaaggatctatttggactcgctagcaatgagcatgacctctcaatggcaaaatacagcaggctgcctaagaaaaaggagaatgagaaggtgaagaccgaagtcggaaaagaggtggccgcggcccggcggaagcagcatctctcctcccttcagtactactgtgccctcaacgcgctgcagtacagaaagcaaatggccatgatggagcccatgataggctttgcccatggacagattaacttttttaagaagggagcagagatgttttccaaacgtatggacagctttttatcctccgttgcagacatggttcaaagcattcaggtagaactggaagccgaggcggaaaagatgcgggtgtcccagcaagaattactttctgttgatgaatctgtttacactccagactctgatgtggccgcaccacagatcaacaggaacctcatccagaaggctggttaccttaatcttagaaacaaaacagggctggtcaccaccacctgggagaggctttatttcttcacccaaggcgggaatctcatgtgtcagcccaggggagccgtggctggaggtttgatccaggacctggacaactgctcagtgatggccgtggattgcgaagaccggcgctactgcttccagatcaccacgcccaatggaaaatcgggaataatcctccaggctgagagcagaaaggaaaatgaagagtggatatgtgcaataaacaacatctccagacagatctacctgaccgacaaccctgaggcagtcgcgatcaagttgaatcagaccgctctgcaagcagtgactcccattacaagttttggaaaaaaacaagaaagctcatgccccagccagaacctgaaaaattcagagatggaaaatgaaaatgacaagattgttcccaaagtaacagccagtctacctgaagcagaggagctgatcgcgcctggaacgccgattcaattcgatattgtgcttcctgctacagaattccttgatcagaacagagggagcaggcgtaccaacccttttggtgaaactgaggatgaatcatttccagaagcagaagattctcttttgcagcagatgtttatagttcggtttttgggatcaatggcagttaaaacagacagcactactgaagtgatttatgaagcgatgagacaagtattggctgctcgggctattcataacatcttccgcatgacagaatcccatctgatggtcaccagtcaatctttgaggttgatagatccacagactcaagtatcaagggccaattttgaacttaccagtgtcacacaatttgctgctcatcaagaaaacaagagactggttggttttgtcatccgtgttcctgaatccactggagaagaatctctgagtacatacatttttgaaagcaactcagaaggcgaaaagatatgttatgctattaatttgggaaaagaaattattgaggttcagaaggatccagaagcactggctcaattaatgctgtccataccactaaccaatgatggaaaatatgtactgttaaacgatcaaccagatgacgatgatggaaatccaaatgaacatagaggcgcagaatccgaagcataa
Sequence Length
1995
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
75,184 Da
NCBI Official Full Name
Homo sapiens adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2, mRNA
NCBI Official Synonym Full Names
adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2
NCBI Official Symbol
APPL2
NCBI Official Synonym Symbols
DIP13B
NCBI Protein Information
DCC-interacting protein 13-beta
UniProt Protein Name
DCC-interacting protein 13-beta
Protein Family
UniProt Gene Name
APPL2
UniProt Synonym Gene Names
DIP13B; Dip13-beta
UniProt Entry Name
DP13B_HUMAN

NCBI Description

The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome. [provided by RefSeq, Oct 2011]

Uniprot Description

APPL2: a Rab5 effector protein that resides on a subpopulation of endosomes. Required for the regulation of cell proliferation in response to extracellular signals mediated by an early endosomal compartment. Links Rab5 to nuclear signal transduction. Its function requires Rab5 binding. Translocated into the nucleus upon release from endosomal membranes following internalization of EGF. Binds to subunits of the the nucleosome remodeling and deacetylase (NuRD) complex, an abundant and widely expressed deacetylase complex. The NURD complex contains both histone deacetylation and chromatin remodeling ATPase activities. Contains a PH domain and a phosphotyrosine interaction domain (PID) domain that has a structure similar to the insulin receptor substrate-1 PTB domain.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 12q24.1

Cellular Component: cytoplasm; endosome membrane; nucleus; NuRD complex

Molecular Function: protein binding

Biological Process: cell proliferation; signal transduction

Research Articles on APPL2

Similar Products

Product Notes

The APPL2 appl2 (Catalog #AAA1273926) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccgccg tggacaagct cctgctagag gaggcgttgc aggacagccc ccagactcgc tctttactga gcgtgtttga agaagatgct ggcaccctca cagactatac caaccagctg ctccaggcaa tgcagcgcgt ctatggagcc cagaatgaga tgtgcctggc cacacaacag ctttctaagc aactgctggc atatgaaaaa cagaactttg ctcttggcaa aggtgatgaa gaagtaattt caacactcca ctatttttcc aaagtggtgg atgagcttaa tcttctccat acagagctgg ctaaacagtt ggcagacaca atggttctac ctatcataca attccgagaa aaggatctca cagaagtaag cactttaaag gatctatttg gactcgctag caatgagcat gacctctcaa tggcaaaata cagcaggctg cctaagaaaa aggagaatga gaaggtgaag accgaagtcg gaaaagaggt ggccgcggcc cggcggaagc agcatctctc ctcccttcag tactactgtg ccctcaacgc gctgcagtac agaaagcaaa tggccatgat ggagcccatg ataggctttg cccatggaca gattaacttt tttaagaagg gagcagagat gttttccaaa cgtatggaca gctttttatc ctccgttgca gacatggttc aaagcattca ggtagaactg gaagccgagg cggaaaagat gcgggtgtcc cagcaagaat tactttctgt tgatgaatct gtttacactc cagactctga tgtggccgca ccacagatca acaggaacct catccagaag gctggttacc ttaatcttag aaacaaaaca gggctggtca ccaccacctg ggagaggctt tatttcttca cccaaggcgg gaatctcatg tgtcagccca ggggagccgt ggctggaggt ttgatccagg acctggacaa ctgctcagtg atggccgtgg attgcgaaga ccggcgctac tgcttccaga tcaccacgcc caatggaaaa tcgggaataa tcctccaggc tgagagcaga aaggaaaatg aagagtggat atgtgcaata aacaacatct ccagacagat ctacctgacc gacaaccctg aggcagtcgc gatcaagttg aatcagaccg ctctgcaagc agtgactccc attacaagtt ttggaaaaaa acaagaaagc tcatgcccca gccagaacct gaaaaattca gagatggaaa atgaaaatga caagattgtt cccaaagtaa cagccagtct acctgaagca gaggagctga tcgcgcctgg aacgccgatt caattcgata ttgtgcttcc tgctacagaa ttccttgatc agaacagagg gagcaggcgt accaaccctt ttggtgaaac tgaggatgaa tcatttccag aagcagaaga ttctcttttg cagcagatgt ttatagttcg gtttttggga tcaatggcag ttaaaacaga cagcactact gaagtgattt atgaagcgat gagacaagta ttggctgctc gggctattca taacatcttc cgcatgacag aatcccatct gatggtcacc agtcaatctt tgaggttgat agatccacag actcaagtat caagggccaa ttttgaactt accagtgtca cacaatttgc tgctcatcaa gaaaacaaga gactggttgg ttttgtcatc cgtgttcctg aatccactgg agaagaatct ctgagtacat acatttttga aagcaactca gaaggcgaaa agatatgtta tgctattaat ttgggaaaag aaattattga ggttcagaag gatccagaag cactggctca attaatgctg tccataccac taaccaatga tggaaaatat gtactgttaa acgatcaacc agatgacgat gatggaaatc caaatgaaca tagaggcgca gaatccgaag cataa. It is sometimes possible for the material contained within the vial of "APPL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.