Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOM cdna clone

APOM cDNA Clone

Gene Names
APOM; G3a; NG20; apo-M; HSPC336
Synonyms
APOM; APOM cDNA Clone; APOM cdna clone
Ordering
For Research Use Only!
Sequence
atgttccaccaaatttgggcagctctgctctacttctatggtattatccttaactccatctaccagtgccctgagcacagtcaactgacaactctgggcgtggatgggaaggagttcccagaggtccacttgggccagtggtactttatcgcaggggcagctcccaccaaggaggagttggcaacttttgaccctgtggacaacattgtcttcaatatggctgctggctctgccccgatgcagctccaccttcgtgctaccatccgcatgaaagatgggctctgtgtgccccggaaatggatctaccacctgactgaagggagcacagatctcagaactgaaggccgccctgacatgaagactgagctcttttccagctcatgcccaggtggaatcatgctgaatgagacaggccagggttaccagcgctttctcctctacaatcgctcaccacatcctcccgaaaagtgtgtggaggaattcaagtccctgacttcctgcctggactccaaagccttcttattgactcctaggaatcaagaggcctgtgagctgtccaataactga
Sequence Length
567
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,051 Da
NCBI Official Full Name
Homo sapiens apolipoprotein M, mRNA
NCBI Official Synonym Full Names
apolipoprotein M
NCBI Official Symbol
APOM
NCBI Official Synonym Symbols
G3a; NG20; apo-M; HSPC336
NCBI Protein Information
apolipoprotein M
UniProt Protein Name
Apolipoprotein M
Protein Family
UniProt Gene Name
APOM
UniProt Synonym Gene Names
G3A; NG20; Apo-M; ApoM
UniProt Entry Name
APOM_HUMAN

NCBI Description

The protein encoded by this gene is an apolipoprotein and member of the lipocalin protein family. It is found associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. The encoded protein is secreted through the plasma membrane but remains membrane-bound, where it is involved in lipid transport. Alternate splicing results in both coding and non-coding variants of this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

APOM: Probably involved in lipid transport. Can bind sphingosine-1-phosphate, myristic acid, palmitic acid and stearic acid, retinol, all-trans-retinoic acid and 9-cis-retinoic acid. Plasma protein. Expressed in liver and kidney. Belongs to the calycin superfamily. Lipocalin family. Highly divergent.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 6p21.33

Cellular Component: extracellular region; integral to plasma membrane

Molecular Function: antioxidant activity; lipid transporter activity; phospholipid binding

Biological Process: cholesterol efflux; cholesterol homeostasis; retinoid metabolic process; reverse cholesterol transport

Research Articles on APOM

Similar Products

Product Notes

The APOM apom (Catalog #AAA1275808) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccacc aaatttgggc agctctgctc tacttctatg gtattatcct taactccatc taccagtgcc ctgagcacag tcaactgaca actctgggcg tggatgggaa ggagttccca gaggtccact tgggccagtg gtactttatc gcaggggcag ctcccaccaa ggaggagttg gcaacttttg accctgtgga caacattgtc ttcaatatgg ctgctggctc tgccccgatg cagctccacc ttcgtgctac catccgcatg aaagatgggc tctgtgtgcc ccggaaatgg atctaccacc tgactgaagg gagcacagat ctcagaactg aaggccgccc tgacatgaag actgagctct tttccagctc atgcccaggt ggaatcatgc tgaatgagac aggccagggt taccagcgct ttctcctcta caatcgctca ccacatcctc ccgaaaagtg tgtggaggaa ttcaagtccc tgacttcctg cctggactcc aaagccttct tattgactcc taggaatcaa gaggcctgtg agctgtccaa taactga. It is sometimes possible for the material contained within the vial of "APOM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.