Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOBEC3G cdna clone

APOBEC3G cDNA Clone

Gene Names
APOBEC3G; A3G; ARCD; ARP9; ARP-9; CEM15; CEM-15; MDS019; bK150C2.7; dJ494G10.1
Synonyms
APOBEC3G; APOBEC3G cDNA Clone; APOBEC3G cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcctcacttcagaaacacagtggagcgaatgtatcgagacacattctcctacaacttttataatagacccatcctttctcgtcggaataccgtctggctgtgctacgaagtgaaaacaaagggtccctcaaggccccctttggacgcaaagatctttcgaggccaggtaccacccggactccaatcactttgcaggcaggagctaagccagctgggaaagcaaaccacgcactga
Sequence Length
240
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,386 Da
NCBI Official Full Name
Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G, mRNA
NCBI Official Synonym Full Names
apolipoprotein B mRNA editing enzyme catalytic subunit 3G
NCBI Official Symbol
APOBEC3G
NCBI Official Synonym Symbols
A3G; ARCD; ARP9; ARP-9; CEM15; CEM-15; MDS019; bK150C2.7; dJ494G10.1
NCBI Protein Information
DNA dC->dU-editing enzyme APOBEC-3G
UniProt Protein Name
DNA dC->dU-editing enzyme APOBEC-3G
Protein Family
UniProt Gene Name
APOBEC3G
UniProt Synonym Gene Names
APOBEC-related protein; ARCD; ARP-9; CEM15; A3G
UniProt Entry Name
ABC3G_HUMAN

NCBI Description

This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. The protein encoded by this gene has been found to be a specific inhibitor of human immunodeficiency virus-1 (HIV-1) infectivity. [provided by RefSeq, Jul 2008]

Uniprot Description

APOBEC3G: DNA deaminase (cytidine deaminase) that mediates a form of innate resistance to retroviral infections (at least to HIV-1 infection) by triggering G-to-A hypermutation in the newly synthesized viral DNA. The replacements C-to-U in the minus strand DNA of HIV-1 during reverse transcription, leads to G-to-A transitions in the plus strand. The inhibition of viral replication is either due to the degradation of the minus strand before its integration or to the lethality of the hypermutations. Modification of both DNA strands is not excluded. This antiviral activity is neutralized by the virion infectivity factor (VIF), that prevents the incorporation of APOBEC3G into progeny HIV-1 virions by both inhibiting its translation and/or by inducing its ubiquitination and subsequent degradation by the 26S proteasome. May also prevent the transposition of a subset of retroelements. Binds a variety of RNAs, but does not display detectable APOB, NF1 and NAT1 mRNA editing. Belongs to the cytidine and deoxycytidylate deaminase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA processing; Hydrolase; EC 3.5.4.-; RNA-binding

Chromosomal Location of Human Ortholog: 22q13.1-q13.2

Cellular Component: apolipoprotein B mRNA editing enzyme complex; cytoplasm; cytosol; ribonucleoprotein complex

Molecular Function: cytidine deaminase activity; dCTP deaminase activity; deoxycytidine deaminase activity; protein binding; RNA binding; zinc ion binding

Biological Process: base conversion or substitution editing; cytidine deamination; defense response to virus; innate immune response; negative regulation of retroviral genome replication; negative regulation of viral genome replication; negative regulation of viral reproduction; positive regulation of defense response to virus by host

Research Articles on APOBEC3G

Similar Products

Product Notes

The APOBEC3G apobec3g (Catalog #AAA1278959) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcctc acttcagaaa cacagtggag cgaatgtatc gagacacatt ctcctacaac ttttataata gacccatcct ttctcgtcgg aataccgtct ggctgtgcta cgaagtgaaa acaaagggtc cctcaaggcc ccctttggac gcaaagatct ttcgaggcca ggtaccaccc ggactccaat cactttgcag gcaggagcta agccagctgg gaaagcaaac cacgcactga. It is sometimes possible for the material contained within the vial of "APOBEC3G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.