Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOBEC3F cdna clone

APOBEC3F cDNA Clone

Gene Names
APOBEC3F; A3F; KA6; ARP8; BK150C2.4.MRNA
Synonyms
APOBEC3F; APOBEC3F cDNA Clone; APOBEC3F cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcctcacttcagaaacacagtggagcgaatgtatcgagacacattctcctacaacttttataatagacccatcctttctcgtcggaataccgtctggctgtgctacgaagtgaaaacaaagggtccctcaaggccccgtttggacgcaaagatctttcgaggccaggtgtattcccagcctgagcaccacgcagaaatgtgcttcctctcttggttctgtggcaaccagctgcctgcttacaagtgtttccagatcacctggtttgtatcctggaccccctgcccggactgtgtggcgaagctggccgaattcctgtctgagcaccccaatgtcaccctgaccatctccgccgcccgcctctactactactgggaaagagattaccgaagggcgctctgcaggctgagtcaggcaggggcccgtgtgaagattatggacgatgaagaatttgcatactgctgggaaaactttgtgtacagtgaaggtcagccattcatgccttggtacaaattcgatgacaattatgcattcctgcaccgcacgctaaaggagattctcagaaacccgatggaggcaatgtatccacacatattctacttccactttaaaaacctacgcaaagcctatggtcggaacgaaagctggctgtgcttcaccatggaagttgtaaagcaccactcacctatctcctggaagaggggcgtcttccgaaaccaggtggatcctgagacccattgtcatgcagaaaggtgcttcctctcttggttctgtgacgacatactgtctcctaacacaaactacgaggtcacctggtacacatcttggagcccttgcccagagtgtgcaggggaggtggccgagttcctggccaggcacagcaacgtgaatctcaccatcttcaccgcccgcctctactacttctgggatacagattaccaggaggggctccgcagcctgagtcaggaaggggcctccgtggagatcatgggctacaaagattttaaatattgttgggaaaactttgtgtacaatgatgatgagccattcaagccttggaaaggactaaaatacaactttctattcctggacagcaagctgcaggagattctcgagtga
Sequence Length
1122
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,823 Da
NCBI Official Full Name
Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F, mRNA
NCBI Official Synonym Full Names
apolipoprotein B mRNA editing enzyme catalytic subunit 3F
NCBI Official Symbol
APOBEC3F
NCBI Official Synonym Symbols
A3F; KA6; ARP8; BK150C2.4.MRNA
NCBI Protein Information
DNA dC->dU-editing enzyme APOBEC-3F
UniProt Protein Name
DNA dC->dU-editing enzyme APOBEC-3F
Protein Family
UniProt Gene Name
APOBEC3F
UniProt Synonym Gene Names
A3F
UniProt Entry Name
ABC3F_HUMAN

NCBI Description

This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

APOBEC3F: Host cellular restriction factor that may have antiviral activities against exogenous and endogenous viruses, as well as retrotransposons. After being packaged into HIV-1 virions, blocks productive infection by massively editing dC residues to dU on the DNA minus strand during reverse transcription. The editing of the minus strand DNA of HIV-1 during reverse transcription leads to G- to-A transitions in the plus strand. The inhibition of viral replication is either due to the degradation of the minus strand before its integration or to the lethality of the hypermutations. May also play a role in the epigenetic regulation of gene expression through the process of active DNA demethylation. Belongs to the cytidine and deoxycytidylate deaminase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA processing; EC 3.5.4.-; Hydrolase

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: apolipoprotein B mRNA editing enzyme complex; cytoplasm; ribonucleoprotein complex

Molecular Function: cytidine deaminase activity; protein binding; RNA binding; zinc ion binding

Biological Process: base conversion or substitution editing; defense response to virus; innate immune response; negative regulation of retroviral genome replication; negative regulation of viral genome replication; negative regulation of viral reproduction; positive regulation of defense response to virus by host

Research Articles on APOBEC3F

Similar Products

Product Notes

The APOBEC3F apobec3f (Catalog #AAA1276901) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcctc acttcagaaa cacagtggag cgaatgtatc gagacacatt ctcctacaac ttttataata gacccatcct ttctcgtcgg aataccgtct ggctgtgcta cgaagtgaaa acaaagggtc cctcaaggcc ccgtttggac gcaaagatct ttcgaggcca ggtgtattcc cagcctgagc accacgcaga aatgtgcttc ctctcttggt tctgtggcaa ccagctgcct gcttacaagt gtttccagat cacctggttt gtatcctgga ccccctgccc ggactgtgtg gcgaagctgg ccgaattcct gtctgagcac cccaatgtca ccctgaccat ctccgccgcc cgcctctact actactggga aagagattac cgaagggcgc tctgcaggct gagtcaggca ggggcccgtg tgaagattat ggacgatgaa gaatttgcat actgctggga aaactttgtg tacagtgaag gtcagccatt catgccttgg tacaaattcg atgacaatta tgcattcctg caccgcacgc taaaggagat tctcagaaac ccgatggagg caatgtatcc acacatattc tacttccact ttaaaaacct acgcaaagcc tatggtcgga acgaaagctg gctgtgcttc accatggaag ttgtaaagca ccactcacct atctcctgga agaggggcgt cttccgaaac caggtggatc ctgagaccca ttgtcatgca gaaaggtgct tcctctcttg gttctgtgac gacatactgt ctcctaacac aaactacgag gtcacctggt acacatcttg gagcccttgc ccagagtgtg caggggaggt ggccgagttc ctggccaggc acagcaacgt gaatctcacc atcttcaccg cccgcctcta ctacttctgg gatacagatt accaggaggg gctccgcagc ctgagtcagg aaggggcctc cgtggagatc atgggctaca aagattttaa atattgttgg gaaaactttg tgtacaatga tgatgagcca ttcaagcctt ggaaaggact aaaatacaac tttctattcc tggacagcaa gctgcaggag attctcgagt ga. It is sometimes possible for the material contained within the vial of "APOBEC3F, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.