Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AP1S1 cdna clone

AP1S1 cDNA Clone

Gene Names
AP1S1; AP19; EKV3; CLAPS1; MEDNIK; SIGMA1A
Synonyms
AP1S1; AP1S1 cDNA Clone; AP1S1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgcggttcatgctattattcagccggcagggaaaactgcggctgcaaaaatggtacctggccacttcggacaaggaacggaagaagatggtgcgcgagctcatgcaggttgtcctggctcgaaagcccaagatgtgcagcttcctggagtggagggacctcaaagttgtctataagagatatgccagcctctacttctgctgcgccatcgagggccaagacaatgagctcatcacactggagctgatccaccgatacgtggagctcttagacaaatactttggcagtgtgtgcgagctggacatcatcttcaactttgagaaggcctacttcatcctggatgagtttttgatggggggggatgtccaggacacctccactttccccttttcccactga
Sequence Length
402
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,011 Da
NCBI Official Full Name
Homo sapiens adaptor-related protein complex 1, sigma 1 subunit, mRNA
NCBI Official Synonym Full Names
adaptor related protein complex 1 sigma 1 subunit
NCBI Official Symbol
AP1S1
NCBI Official Synonym Symbols
AP19; EKV3; CLAPS1; MEDNIK; SIGMA1A
NCBI Protein Information
AP-1 complex subunit sigma-1A
UniProt Protein Name
AP-1 complex subunit sigma-1A
Protein Family
UniProt Gene Name
AP1S1
UniProt Synonym Gene Names
AP19; CLAPS1
UniProt Entry Name
AP1S1_HUMAN

NCBI Description

The protein encoded by this gene is part of the clathrin coat assembly complex which links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. This protein, as well as beta-prime-adaptin, gamma-adaptin, and the medium (mu) chain AP47, form the AP-1 assembly protein complex located at the Golgi vesicle. [provided by RefSeq, Jul 2008]

Uniprot Description

AP1S1: Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes. The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules. Belongs to the adaptor complexes small subunit family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: AP-1 adaptor complex; cytoplasmic vesicle membrane; cytosol; Golgi apparatus; Golgi membrane; intracellular membrane-bound organelle; lysosomal membrane; membrane; trans-Golgi network membrane

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; receptor-mediated endocytosis; regulation of defense response to virus by virus; response to virus

Disease: Mental Retardation, Enteropathy, Deafness, Peripheral Neuropathy, Ichthyosis, And Keratoderma

Research Articles on AP1S1

Similar Products

Product Notes

The AP1S1 ap1s1 (Catalog #AAA1272918) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgcggt tcatgctatt attcagccgg cagggaaaac tgcggctgca aaaatggtac ctggccactt cggacaagga acggaagaag atggtgcgcg agctcatgca ggttgtcctg gctcgaaagc ccaagatgtg cagcttcctg gagtggaggg acctcaaagt tgtctataag agatatgcca gcctctactt ctgctgcgcc atcgagggcc aagacaatga gctcatcaca ctggagctga tccaccgata cgtggagctc ttagacaaat actttggcag tgtgtgcgag ctggacatca tcttcaactt tgagaaggcc tacttcatcc tggatgagtt tttgatgggg ggggatgtcc aggacacctc cactttcccc ttttcccact ga. It is sometimes possible for the material contained within the vial of "AP1S1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.