Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AP1G1 cdna clone

AP1G1 cDNA Clone

Gene Names
AP1G1; ADTG; CLAPG1
Synonyms
AP1G1; AP1G1 cDNA Clone; AP1G1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagcccccatcagattgcgggagctgatccggaccatccggacagcccgaacccaagctgaagaacgagaaatgatccagaaagaatgtgctgcaatccggtcatcttttagagaagaagacaatacataccgatgtcggaatgtggcaaaattactgtatatgcacatgctgggctaccctgctcactttggacagttggagtgcttcaagcttattgcctctcaaaaatttacagacaaacgcattggctatttaggggcaatgctgctgttagatgaaagacaagatgtccatcttctcatgaccaactgtatcaagaatgatcttaatcatagcacgcaattcgtacaggggttagcactttgtaccctcggctgcatgggctcctcagagatgtgcagagatcttgcaggagaggtagagaagctcctgaaaacctccaactcttacttaagaaaaaaggcagcactgtgtgctgttcatgtcatcaggaaagttcctgaacttatggagatgtttttaccagcaacaaaaaatttattgaatgagaagaaccatggtgtcctccacacatctgtagtcctcctcacagaaatgtgtgagcgaagcccagacatgcttgcgcatttcagaaagaatgaaaagcttgtgccccaattagttcgtattttaaagaacctcatcatgtccggatattcaccagaacatgatgtttctggtatcagtgacccctttttgcaggtacgaattttgcggttattaagaattttaggacgaaatgatgatgattcaagtgaagctatgaatgatatattagcacaggttgccactaatactgagactagtaaaaatgtaggaaatgctattctttatgaaacggttttgactatcatggatattaagtcagagagtggattgcgagtcctagccataaatatcctgggtcgtttcttattgaacaatgacaagaatattagatatgtggctctgacatctttgttgaagactgtacagacagatcataatgcagtacagaggcacagaagcacaattgtggactgtcttaaagatttggatgtctcaataaaacggcgtgcaatggaattgagttttgccctggtaaatgggaataatatccgaggcatgatgaaagaattactttattttctggattcgtgtgagccagaatttaaagcagactgtgcatctggaatctttcttgctgcagaaaagtatgcaccttccaaacgatggcatatagacacaattatgcgtgttttgacaacggcaggaagttatgttcgtgatgatgcagtccccaatttaatccagttaataactaatagtgtggagatgcatgcctatactgtccagcgcctgtacaaagcaattcttggtgattattctcaacaacctttggtacaagtggctgcatggtgtataggtgaatatggtgatcttcttgtatctggccagtgtgaagaggaagagcctattcaggtaacagaggatgaagtgttggatattttagaaagtgtcctaatctctaatatgtccacctctgtgacacgaggttatgccctcactgccattatgaagctttccactcgattcacttgtactgtaaaccgaattaagaaagtggtttccatctacggaagcagcattgatgtggaactccagcagagggcagtagaatataatgcacttttcaagaaatatgaccacatgaggtctgccctacttgagagaatgcctgtcatggaaaaagtgaccacaaatggccctactgagattgtgcagacaaatggagagacagaaccagctccactagagaccaaaccgccaccctctgggccacagcccaccagccaggccaatgatttattggatttgttgggaggaaatgacataacacctgttattccaactgcgcctacaagcaaaccatcttctgctggtggagaacttcttgatttgctgggagacatcaaccttacaggtgctccagctgctgctcctgcccctgcctcagtcccacagatatcccagccccccttcttgttggatgggctttcatcacagcctctcttcaatgatattgctgcaggcatcccctccatcacagcatacagtaagaatggcttgaagatagaattcacctttgaacggtcaaataccaaccccagtgtaacagtgataacgatacaggcctccaacagcacagagctagatatgacggactttgttttccaagctgcagtaccaaagacattccagctgcagctcttgtctcctagcagcagcattgtcccagcatttaacacggggaccatcacacaagtcattaaagttctgaaccctcagaagcaacagctgcgaatgcggatcaagcttacatataatcacaagggctcagcaatgcaagatctagcagaggtgaacaactttccccctcagtcctggcaatga
Sequence Length
2478
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
164
Molecular Weight
91,723 Da
NCBI Official Full Name
Homo sapiens adaptor-related protein complex 1, gamma 1 subunit, mRNA
NCBI Official Synonym Full Names
adaptor related protein complex 1 gamma 1 subunit
NCBI Official Symbol
AP1G1
NCBI Official Synonym Symbols
ADTG; CLAPG1
NCBI Protein Information
AP-1 complex subunit gamma-1
UniProt Protein Name
AP-1 complex subunit gamma-1
Protein Family
UniProt Gene Name
AP1G1
UniProt Synonym Gene Names
ADTG; CLAPG1
UniProt Entry Name
AP1G1_HUMAN

NCBI Description

Adaptins are important components of clathrin-coated vesicles transporting ligand-receptor complexes from the plasma membrane or from the trans-Golgi network to lysosomes. The adaptin family of proteins is composed of four classes of molecules named alpha, beta-, beta prime- and gamma- adaptins. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. The protein encoded by this gene is a gamma-adaptin protein and it belongs to the adaptor complexes large subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

AP1G1: Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes. The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules. Belongs to the adaptor complexes large subunit family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 16q23

Cellular Component: AP-type membrane coat adaptor complex; clathrin coated vesicle membrane; clathrin-coated vesicle; cytoplasm; cytoplasmic vesicle membrane; cytosol; Golgi apparatus; Golgi membrane; intracellular membrane-bound organelle; lysosomal membrane; membrane; recycling endosome; trans-Golgi network membrane

Molecular Function: GTP-dependent protein binding; kinesin binding; protein binding; Rab GTPase binding; transporter activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; melanosome organization and biogenesis; positive regulation of natural killer cell degranulation; positive regulation of natural killer cell mediated cytotoxicity; regulation of defense response to virus by virus

Research Articles on AP1G1

Similar Products

Product Notes

The AP1G1 ap1g1 (Catalog #AAA1270721) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagccc ccatcagatt gcgggagctg atccggacca tccggacagc ccgaacccaa gctgaagaac gagaaatgat ccagaaagaa tgtgctgcaa tccggtcatc ttttagagaa gaagacaata cataccgatg tcggaatgtg gcaaaattac tgtatatgca catgctgggc taccctgctc actttggaca gttggagtgc ttcaagctta ttgcctctca aaaatttaca gacaaacgca ttggctattt aggggcaatg ctgctgttag atgaaagaca agatgtccat cttctcatga ccaactgtat caagaatgat cttaatcata gcacgcaatt cgtacagggg ttagcacttt gtaccctcgg ctgcatgggc tcctcagaga tgtgcagaga tcttgcagga gaggtagaga agctcctgaa aacctccaac tcttacttaa gaaaaaaggc agcactgtgt gctgttcatg tcatcaggaa agttcctgaa cttatggaga tgtttttacc agcaacaaaa aatttattga atgagaagaa ccatggtgtc ctccacacat ctgtagtcct cctcacagaa atgtgtgagc gaagcccaga catgcttgcg catttcagaa agaatgaaaa gcttgtgccc caattagttc gtattttaaa gaacctcatc atgtccggat attcaccaga acatgatgtt tctggtatca gtgacccctt tttgcaggta cgaattttgc ggttattaag aattttagga cgaaatgatg atgattcaag tgaagctatg aatgatatat tagcacaggt tgccactaat actgagacta gtaaaaatgt aggaaatgct attctttatg aaacggtttt gactatcatg gatattaagt cagagagtgg attgcgagtc ctagccataa atatcctggg tcgtttctta ttgaacaatg acaagaatat tagatatgtg gctctgacat ctttgttgaa gactgtacag acagatcata atgcagtaca gaggcacaga agcacaattg tggactgtct taaagatttg gatgtctcaa taaaacggcg tgcaatggaa ttgagttttg ccctggtaaa tgggaataat atccgaggca tgatgaaaga attactttat tttctggatt cgtgtgagcc agaatttaaa gcagactgtg catctggaat ctttcttgct gcagaaaagt atgcaccttc caaacgatgg catatagaca caattatgcg tgttttgaca acggcaggaa gttatgttcg tgatgatgca gtccccaatt taatccagtt aataactaat agtgtggaga tgcatgccta tactgtccag cgcctgtaca aagcaattct tggtgattat tctcaacaac ctttggtaca agtggctgca tggtgtatag gtgaatatgg tgatcttctt gtatctggcc agtgtgaaga ggaagagcct attcaggtaa cagaggatga agtgttggat attttagaaa gtgtcctaat ctctaatatg tccacctctg tgacacgagg ttatgccctc actgccatta tgaagctttc cactcgattc acttgtactg taaaccgaat taagaaagtg gtttccatct acggaagcag cattgatgtg gaactccagc agagggcagt agaatataat gcacttttca agaaatatga ccacatgagg tctgccctac ttgagagaat gcctgtcatg gaaaaagtga ccacaaatgg ccctactgag attgtgcaga caaatggaga gacagaacca gctccactag agaccaaacc gccaccctct gggccacagc ccaccagcca ggccaatgat ttattggatt tgttgggagg aaatgacata acacctgtta ttccaactgc gcctacaagc aaaccatctt ctgctggtgg agaacttctt gatttgctgg gagacatcaa ccttacaggt gctccagctg ctgctcctgc ccctgcctca gtcccacaga tatcccagcc ccccttcttg ttggatgggc tttcatcaca gcctctcttc aatgatattg ctgcaggcat cccctccatc acagcataca gtaagaatgg cttgaagata gaattcacct ttgaacggtc aaataccaac cccagtgtaa cagtgataac gatacaggcc tccaacagca cagagctaga tatgacggac tttgttttcc aagctgcagt accaaagaca ttccagctgc agctcttgtc tcctagcagc agcattgtcc cagcatttaa cacggggacc atcacacaag tcattaaagt tctgaaccct cagaagcaac agctgcgaat gcggatcaag cttacatata atcacaaggg ctcagcaatg caagatctag cagaggtgaa caactttccc cctcagtcct ggcaatga. It is sometimes possible for the material contained within the vial of "AP1G1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.