Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AOAH cdna clone

AOAH cDNA Clone

Synonyms
AOAH; AOAH cDNA Clone; AOAH cdna clone
Ordering
For Research Use Only!
Sequence
atgcagtccccctggaaaatccttacggtggcgcctctattcttgctcctgtctcttcagtcctcagcctctccagccaacgatgaccagtccaggcccagcctctcgaatgggcacacctgtgtagggtgtgtgctggtggtgtctgtaatagaacagcttgctcaagttcacaactcgacggtccaggcctcgatggagagactgtgcagctacctgcctgaaaaactgttcttgaaaaccacctgctatttagtcattgacaagtttggatcagacatcataaaactgcttagcgcagatatgaatgctgatgtggtatgtcacactctggagttttgtaaacagaacactggccaaccattgtgtcatctctaccctcttcccaaggagacatggaaatttacactacagaaggcaagacaaattgtcaagaagtccccgattctgaaatattctagaagtggttctgacatttgttcactcccggttttggccaagatctgccagaaaattaaattagctatggaacagtctgtgccattcaaagatgtggattcagacaaatacagcgttttcccaacactgcggggctatcactggcgggggagagactgtaatgacagcgacgagtcagtgtacccaggtagaaggccgaacaactgggatgtccatcaggattcaaactgtaatggcatttggggtgtcgatccaaaagatggagttccatatgagaagaaattctgtgaaggttcacagcccaggggaatcattttgctgggagactcagctggggctcattttcacatctctcctgaatggatcacagcgtcgcagatgtctttgaactctttcatcaatctaccaacagcccttaccaacgagcttgactggccccaactctctggtgctacaggatttctggactccactgttggaattaaagaaaaatctatttaccttcgcttatggaaaagaaaccactgtaatcacagggactaccagaatatttcaagaaatggtgcatcttcccgaaacctgaagaaatttatagaaagcttgtctagaaacaaggtgttggactatcccgccatcgttatatatgccatgattggaaatgatgtctgcagtgggaagagtgacccagtcccagccatgaccactcctgagaaactctactccaacgtcatgcagactctgaagcatctaaattcccacctgcccaatggcagccatgttattttgtatggcttaccagatggaacctttctctgggataatttgcacaacagatatcatcctctcggccagctaaataaagacatgacctatgcgcagttgtactccttcctgaactgcctccaggtcagcccctgccacggctggatgtcttccaacaagacgttgcggactctcacttcagagagagcagagcaactctccaacacactgaaaaaaattgcagccagtgagaaatttacaaacttcaatcttttctacatggattttgccttccatgaaatcatacaggagtggcagaagagaggcggacagccctggcagctcatcgagcccgtggatggattccaccccaacgaggtggctttgctgttgttggcggatcatttctggaaaaaggtgcagctccagtggccccaaatcctgggaaaggagaatccgttcaacccccagattaaacaggtgtttggagaccaaggcgggcactga
Sequence Length
1728
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
313
Molecular Weight
61,647 Da
NCBI Official Full Name
Homo sapiens acyloxyacyl hydrolase (neutrophil), mRNA
NCBI Official Synonym Full Names
acyloxyacyl hydrolase
NCBI Official Symbol
AOAH
NCBI Protein Information
acyloxyacyl hydrolase
UniProt Protein Name
Acyloxyacyl hydrolase
Protein Family
UniProt Gene Name
AOAH
UniProt Entry Name
AOAH_HUMAN

NCBI Description

This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Apr 2010]

Uniprot Description

AOAH: Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.1.77; Secreted, signal peptide; Secreted; Lipase

Chromosomal Location of Human Ortholog: 7p14.2

Molecular Function: catalytic activity; lipoprotein lipase activity

Biological Process: inflammatory response; lipid metabolic process

Research Articles on AOAH

Similar Products

Product Notes

The AOAH aoah (Catalog #AAA1278232) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagtccc cctggaaaat ccttacggtg gcgcctctat tcttgctcct gtctcttcag tcctcagcct ctccagccaa cgatgaccag tccaggccca gcctctcgaa tgggcacacc tgtgtagggt gtgtgctggt ggtgtctgta atagaacagc ttgctcaagt tcacaactcg acggtccagg cctcgatgga gagactgtgc agctacctgc ctgaaaaact gttcttgaaa accacctgct atttagtcat tgacaagttt ggatcagaca tcataaaact gcttagcgca gatatgaatg ctgatgtggt atgtcacact ctggagtttt gtaaacagaa cactggccaa ccattgtgtc atctctaccc tcttcccaag gagacatgga aatttacact acagaaggca agacaaattg tcaagaagtc cccgattctg aaatattcta gaagtggttc tgacatttgt tcactcccgg ttttggccaa gatctgccag aaaattaaat tagctatgga acagtctgtg ccattcaaag atgtggattc agacaaatac agcgttttcc caacactgcg gggctatcac tggcggggga gagactgtaa tgacagcgac gagtcagtgt acccaggtag aaggccgaac aactgggatg tccatcagga ttcaaactgt aatggcattt ggggtgtcga tccaaaagat ggagttccat atgagaagaa attctgtgaa ggttcacagc ccaggggaat cattttgctg ggagactcag ctggggctca ttttcacatc tctcctgaat ggatcacagc gtcgcagatg tctttgaact ctttcatcaa tctaccaaca gcccttacca acgagcttga ctggccccaa ctctctggtg ctacaggatt tctggactcc actgttggaa ttaaagaaaa atctatttac cttcgcttat ggaaaagaaa ccactgtaat cacagggact accagaatat ttcaagaaat ggtgcatctt cccgaaacct gaagaaattt atagaaagct tgtctagaaa caaggtgttg gactatcccg ccatcgttat atatgccatg attggaaatg atgtctgcag tgggaagagt gacccagtcc cagccatgac cactcctgag aaactctact ccaacgtcat gcagactctg aagcatctaa attcccacct gcccaatggc agccatgtta ttttgtatgg cttaccagat ggaacctttc tctgggataa tttgcacaac agatatcatc ctctcggcca gctaaataaa gacatgacct atgcgcagtt gtactccttc ctgaactgcc tccaggtcag cccctgccac ggctggatgt cttccaacaa gacgttgcgg actctcactt cagagagagc agagcaactc tccaacacac tgaaaaaaat tgcagccagt gagaaattta caaacttcaa tcttttctac atggattttg ccttccatga aatcatacag gagtggcaga agagaggcgg acagccctgg cagctcatcg agcccgtgga tggattccac cccaacgagg tggctttgct gttgttggcg gatcatttct ggaaaaaggt gcagctccag tggccccaaa tcctgggaaa ggagaatccg ttcaaccccc agattaaaca ggtgtttgga gaccaaggcg ggcactga. It is sometimes possible for the material contained within the vial of "AOAH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.