Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANXA5 cdna clone

ANXA5 cDNA Clone

Gene Names
ANXA5; PP4; ANX5; ENX2; RPRGL3; HEL-S-7
Synonyms
ANXA5; ANXA5 cDNA Clone; ANXA5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcacaggttctcagaggcactgtgactgacttccctggatttgatgagcgggctgatgcagaaactcttcggaaggctatgaaaggcttgggcacagatgaggagagcatcctgactctgttgacatcccgaagtaatgctcagcgccaggaaatctctgcagcttttaagactctgtttggcagggatcttctggatgacctgaaatcagaactaactggaaaatttgaaaaattaattgtggctctgatgaaaccctctcggctttatgatgcttatgaactgaaacatgccttgaagggagctggaacaaatgaaaaagtactgacagaaattattgcttcaaggacacctgaagaactgagagccatcaaacaagtttatgaagaagaatatggctcaagcctggaagatgacgtggtgggggacacttcagggtactaccagcggatgttggtggttctccttcaggctaacagagaccctgatgctggaattgatgaagctcaagttgaacaagatgctcaggctttatttcaggctggagaacttaaatgggggacagatgaagaaaagtttatcaccatctttggaacacgaagtgtgtctcatttgagaaaggtgtttgacaagtacatgactatatcaggatttcaaattgaggaaaccattgaccgcgagacttctggcaatttagagcaactactccttgctgttgtgaaatctattcgaagtatacctgcctaccttgcagagaccctctattatgctatgaagggagctgggacagatgatcataccctcatcagagtcatggtttccaggagtgagattgatctgtttaacatcaggaaggagtttaggaagaattttgccacctctctttattccatgattaagggagatacatctggggactataagaaagctcttctgctgctctgtggagaagatgactaa
Sequence Length
963
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
308
Molecular Weight
35,937 Da
NCBI Official Full Name
Homo sapiens annexin A5, mRNA
NCBI Official Synonym Full Names
annexin A5
NCBI Official Symbol
ANXA5
NCBI Official Synonym Symbols
PP4; ANX5; ENX2; RPRGL3; HEL-S-7
NCBI Protein Information
annexin A5
UniProt Protein Name
Annexin A5
Protein Family
UniProt Gene Name
ANXA5
UniProt Synonym Gene Names
ANX5; ENX2; PP4; CBP-I; PP4; PAP-I; VAC-alpha
UniProt Entry Name
ANXA5_HUMAN

NCBI Description

The protein encoded by this gene belongs to the annexin family of calcium-dependent phospholipid binding proteins some of which have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 5 is a phospholipase A2 and protein kinase C inhibitory protein with calcium channel activity and a potential role in cellular signal transduction, inflammation, growth and differentiation. Annexin 5 has also been described as placental anticoagulant protein I, vascular anticoagulant-alpha, endonexin II, lipocortin V, placental protein 4 and anchorin CII. The gene spans 29 kb containing 13 exons, and encodes a single transcript of approximately 1.6 kb and a protein product with a molecular weight of about 35 kDa. [provided by RefSeq, Jul 2008]

Uniprot Description

ANXA5: a calcium/phospholipid-binding protein and an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. The binding of labeled ANXA5 to phosphatidylserine is used as a marker of apoptosis. Annexins are a family of structurally related proteins whose common property is calcium-dependent binding to phospholipids. There are at least ten different annexins in mammalian species. Annexins do not contain signal peptides, yet some annexins (A1, A2 and A5) appear to be secreted in a physiologically regulated fashion.

Protein type: Apoptosis; Calcium-binding; Inhibitor; Lipid-binding

Chromosomal Location of Human Ortholog: 4q27

Cellular Component: cytoplasm; focal adhesion; intracellular; membrane

Molecular Function: calcium-dependent phospholipid binding; phospholipase inhibitor activity; phospholipid binding; protein binding

Biological Process: negative regulation of apoptosis; signal transduction

Disease: Pregnancy Loss, Recurrent, Susceptibility To, 3

Research Articles on ANXA5

Similar Products

Product Notes

The ANXA5 anxa5 (Catalog #AAA1275009) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacagg ttctcagagg cactgtgact gacttccctg gatttgatga gcgggctgat gcagaaactc ttcggaaggc tatgaaaggc ttgggcacag atgaggagag catcctgact ctgttgacat cccgaagtaa tgctcagcgc caggaaatct ctgcagcttt taagactctg tttggcaggg atcttctgga tgacctgaaa tcagaactaa ctggaaaatt tgaaaaatta attgtggctc tgatgaaacc ctctcggctt tatgatgctt atgaactgaa acatgccttg aagggagctg gaacaaatga aaaagtactg acagaaatta ttgcttcaag gacacctgaa gaactgagag ccatcaaaca agtttatgaa gaagaatatg gctcaagcct ggaagatgac gtggtggggg acacttcagg gtactaccag cggatgttgg tggttctcct tcaggctaac agagaccctg atgctggaat tgatgaagct caagttgaac aagatgctca ggctttattt caggctggag aacttaaatg ggggacagat gaagaaaagt ttatcaccat ctttggaaca cgaagtgtgt ctcatttgag aaaggtgttt gacaagtaca tgactatatc aggatttcaa attgaggaaa ccattgaccg cgagacttct ggcaatttag agcaactact ccttgctgtt gtgaaatcta ttcgaagtat acctgcctac cttgcagaga ccctctatta tgctatgaag ggagctggga cagatgatca taccctcatc agagtcatgg tttccaggag tgagattgat ctgtttaaca tcaggaagga gtttaggaag aattttgcca cctctcttta ttccatgatt aagggagata catctgggga ctataagaaa gctcttctgc tgctctgtgg agaagatgac taa. It is sometimes possible for the material contained within the vial of "ANXA5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.