Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKS6 cdna clone

ANKS6 cDNA Clone

Gene Names
ANKS6; PKDR1; SAMD6; NPHP16; ANKRD14
Synonyms
ANKS6; ANKS6 cDNA Clone; ANKS6 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctgaatgatcccgacacggaacttgttcgactgctggcatctgtctgcatgcaggtgaataaagacaaaggccggccgagccaccagcctcccctgccccactcgaaggtccgacagccctggagcatcccagtgctgcccgatgacaagggtggactgaagtcctggtggaaccgaatgtccaatcggttccgaaagctcaaactgatgcagacgctgccccgtgggctgtccagcaaccagcctttgcctttctctgacgagcctgagccagctctggactccacaatgagggctgccccccaggacaagacaagccgctctgcactccctgatgcggcccctgtgaccaaagacaatggtcctgggagcacaagaggagaaaaggaagacacgttattgacaaccatgcttcgaaacggagctcccctcaccagactcccgagtgacaagctgaaagcagtcatccccccattcctacccccttccagttttgagctgtggagctctgatcggtcccggacgcgtcacaacgggaaggcagaccccatgaagactgcgctgccccagagagccagcaggggccaccccgtgggcggcgggggcacagacactacacccgtcaggcctgttaaatttccaagcctccccagaagcccagcctcttctgccaattctggaaacttcaaccactcgcctcattcatcgggcggctccagtgggataggtgtgagccggcacggtggggagctgcttaaccgctcaggtggcagcatagacaatgtcttgtcccaaatcgctgcccagaggaaaaaagcagccggattattggagcagaaacccagccatcggtcaagccctgtggggccagcaccggggtccagcccgtctgagcttccagcctcccctgcaggtggcagcgctcctgttggcaagaaattggagaccagcaaaaggcctccatctggaacttccactacctccaagagcacctctccaaccctcacgccctccccctcacccaaagggcacactgcagagtcctcagtgtcttcctcgtcatcccatcggcagtccaagagcagtgggggctccagcagtggcaccatcacagatgaggatgaactgactggaatccttaagaaattatcacttgagaaatatcagcccatttttgaggaacaagaggtggacatggaagcgttcctcacactgactgacggtgacttgaaggagctgggaattaagacagatgggtccaggcagcagattctggcagcgatttctgaactgaacgcaggcaagggacgcgagagacaaattttacaggaaaccattcacaactttcactcttcctttgagagcagtgccagcaacaccagggcccctggcaacagcccctgtgcgtga
Sequence Length
1416
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
92,347 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and sterile alpha motif domain containing 6, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and sterile alpha motif domain containing 6
NCBI Official Symbol
ANKS6
NCBI Official Synonym Symbols
PKDR1; SAMD6; NPHP16; ANKRD14
NCBI Protein Information
ankyrin repeat and SAM domain-containing protein 6
UniProt Protein Name
Ankyrin repeat and SAM domain-containing protein 6
UniProt Gene Name
ANKS6
UniProt Synonym Gene Names
ANKRD14; PKDR1; SAMD6; SAM domain-containing protein 6
UniProt Entry Name
ANKS6_HUMAN

NCBI Description

This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]

Uniprot Description

ANKS6: Required for renal function. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 9q22.33

Disease: Nephronophthisis 16

Research Articles on ANKS6

Similar Products

Product Notes

The ANKS6 anks6 (Catalog #AAA1278462) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctga atgatcccga cacggaactt gttcgactgc tggcatctgt ctgcatgcag gtgaataaag acaaaggccg gccgagccac cagcctcccc tgccccactc gaaggtccga cagccctgga gcatcccagt gctgcccgat gacaagggtg gactgaagtc ctggtggaac cgaatgtcca atcggttccg aaagctcaaa ctgatgcaga cgctgccccg tgggctgtcc agcaaccagc ctttgccttt ctctgacgag cctgagccag ctctggactc cacaatgagg gctgcccccc aggacaagac aagccgctct gcactccctg atgcggcccc tgtgaccaaa gacaatggtc ctgggagcac aagaggagaa aaggaagaca cgttattgac aaccatgctt cgaaacggag ctcccctcac cagactcccg agtgacaagc tgaaagcagt catcccccca ttcctacccc cttccagttt tgagctgtgg agctctgatc ggtcccggac gcgtcacaac gggaaggcag accccatgaa gactgcgctg ccccagagag ccagcagggg ccaccccgtg ggcggcgggg gcacagacac tacacccgtc aggcctgtta aatttccaag cctccccaga agcccagcct cttctgccaa ttctggaaac ttcaaccact cgcctcattc atcgggcggc tccagtggga taggtgtgag ccggcacggt ggggagctgc ttaaccgctc aggtggcagc atagacaatg tcttgtccca aatcgctgcc cagaggaaaa aagcagccgg attattggag cagaaaccca gccatcggtc aagccctgtg gggccagcac cggggtccag cccgtctgag cttccagcct cccctgcagg tggcagcgct cctgttggca agaaattgga gaccagcaaa aggcctccat ctggaacttc cactacctcc aagagcacct ctccaaccct cacgccctcc ccctcaccca aagggcacac tgcagagtcc tcagtgtctt cctcgtcatc ccatcggcag tccaagagca gtgggggctc cagcagtggc accatcacag atgaggatga actgactgga atccttaaga aattatcact tgagaaatat cagcccattt ttgaggaaca agaggtggac atggaagcgt tcctcacact gactgacggt gacttgaagg agctgggaat taagacagat gggtccaggc agcagattct ggcagcgatt tctgaactga acgcaggcaa gggacgcgag agacaaattt tacaggaaac cattcacaac tttcactctt cctttgagag cagtgccagc aacaccaggg cccctggcaa cagcccctgt gcgtga. It is sometimes possible for the material contained within the vial of "ANKS6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.