ANKS1B cdna clone
ANKS1B cDNA Clone
Gene Names
ANKS1B; EB1; AIDA; EB-1; ANKS2; AIDA-1; cajalin-2
Synonyms
ANKS1B; ANKS1B cDNA Clone; ANKS1B cdna clone
Sequence
atggctaatggatttgacaatgtgcagtttatgggaagcaatgttatggaagatcaggatttgttggaaattggaatccttaattctgggcacagacaaagaattctacaggcaatccagctccttccaaagatgagacccattgggcatgatggctaccatcccacctctgtagctgagtggctggattccattgaactgggcgactacaccaaagcctttctaattaatggctacacttcgatggacctgttgaaaaaaatctgggaggttgaacttattaatcagtcgtctgtctgtgaaatatggacgaatcagaacgcaggatttcctttctcagcgatccatcaggttcataatacaggagactggggagaaccttccattaccttgcgacctccgaatgaagccacagcctctaccccggtacagtactggcagcatcacccagaaaagcttatcttccagtcgtgtgattacaaagctttttatttaggttctatgctgataaaagagcttagggggacagaatcaacccaagatgcttgtgcaaaaatgcgggctaactgtcagaagtctacagagcaaatgaagaaggtccctactattattctttctgtctcatataaaggagtcaaatttattgatgcaacaaataagaacataattgctgagcatgaaattcgtaatatctcctgtgctgcccaggacccagaagacctctcaacatttgcctatatcacaaaagatttgaagtctaatcaccactactgtcatgtgtttactgcctttgatgtgaatttagcctatgaaatcatcctaaccctgggacaggcattcgaagtcgcttaccagctagcactacaagcaagaaaagggggacactcctccacacttccagaaagctttgaaaacaaaccctccaaacccatccccaagccccgcgttagcattcgcaagtccgtgatcgaccgatctgagcaaaagactctggccaatctaccgtggattgtggagccgggccaagaagccaagaggggcattaataccaagtatgaaaccacgattttctga
Sequence Length
1074
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,522 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and sterile alpha motif domain containing 1B
NCBI Official Symbol
ANKS1B
NCBI Official Synonym Symbols
EB1; AIDA; EB-1; ANKS2; AIDA-1; cajalin-2
NCBI Protein Information
ankyrin repeat and sterile alpha motif domain-containing protein 1B
UniProt Protein Name
Ankyrin repeat and sterile alpha motif domain-containing protein 1B
UniProt Gene Name
ANKS1B
UniProt Synonym Gene Names
AIDA-1; EB-1
UniProt Entry Name
ANS1B_HUMAN
NCBI Description
This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
Uniprot Description
AIDA-1b: Isoform 2 may participate in the regulation of nucleoplasmic coilin protein interactions in neuronal and transformed cells. 8 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell adhesion
Chromosomal Location of Human Ortholog: 12q23.1
Molecular Function: ephrin receptor binding
Research Articles on ANKS1B
Similar Products
Product Notes
The ANKS1B anks1b (Catalog #AAA1265936) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaatg gatttgacaa tgtgcagttt atgggaagca atgttatgga agatcaggat ttgttggaaa ttggaatcct taattctggg cacagacaaa gaattctaca ggcaatccag ctccttccaa agatgagacc cattgggcat gatggctacc atcccacctc tgtagctgag tggctggatt ccattgaact gggcgactac accaaagcct ttctaattaa tggctacact tcgatggacc tgttgaaaaa aatctgggag gttgaactta ttaatcagtc gtctgtctgt gaaatatgga cgaatcagaa cgcaggattt cctttctcag cgatccatca ggttcataat acaggagact ggggagaacc ttccattacc ttgcgacctc cgaatgaagc cacagcctct accccggtac agtactggca gcatcaccca gaaaagctta tcttccagtc gtgtgattac aaagcttttt atttaggttc tatgctgata aaagagctta gggggacaga atcaacccaa gatgcttgtg caaaaatgcg ggctaactgt cagaagtcta cagagcaaat gaagaaggtc cctactatta ttctttctgt ctcatataaa ggagtcaaat ttattgatgc aacaaataag aacataattg ctgagcatga aattcgtaat atctcctgtg ctgcccagga cccagaagac ctctcaacat ttgcctatat cacaaaagat ttgaagtcta atcaccacta ctgtcatgtg tttactgcct ttgatgtgaa tttagcctat gaaatcatcc taaccctggg acaggcattc gaagtcgctt accagctagc actacaagca agaaaagggg gacactcctc cacacttcca gaaagctttg aaaacaaacc ctccaaaccc atccccaagc cccgcgttag cattcgcaag tccgtgatcg accgatctga gcaaaagact ctggccaatc taccgtggat tgtggagccg ggccaagaag ccaagagggg cattaatacc aagtatgaaa ccacgatttt ctga. It is sometimes possible for the material contained within the vial of "ANKS1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
