ANKRD13A cdna clone
ANKRD13A cDNA Clone
Gene Names
ANKRD13A; ANKRD13; NY-REN-25
Synonyms
ANKRD13A; ANKRD13A cDNA Clone; ANKRD13A cdna clone
Sequence
atgtcctcggcctgcgacgcgggcgaccactaccccctgcacctcctagtctggaaaaacgactaccggcagctcgagaaggagctgcagggccagaatgtggaggctgtggacccacgaggtcgaacattattgcatcttgctgtttccttgggacatttggaatctgctcgagtcttactccgacataaagcagatgtgacaaaagaaaatcgccagggatggacagttttacatgaggctgtgagcactggcgatcctgagatggtgtacacagttctccaacatcgagactaccacaacacatccatggcccttgagggagttcctgagctgctccaaaaaattctcgaggctccggatttctatgtgcagatgaaatgggaattcaccagctgggtgcccttggtttctagaatatgcccgaatgatgtctgtcgcatctggaaaagtggtgccaaactgcgcgtcgatatcacattgctgggatttgaaaacatgagctggataagagggaggcgtagttttatatttaagggagaagacaactgggcggagttaatggaagtcaaccatgatgacaaagtggtcaccaccgaacgcttcgacctttcccaagaaatggagcgcctcactctggacttgatgaagccaaaaagcagggaagttgagcggcggctcacaagccctgtcattaacaccagcctcgatactaaaaatattgcttttgaaagggttttcagagttctcaagctaactcttttgcaactgacagtgtgtagctga
Sequence Length
786
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,619 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat domain 13A, mRNA
NCBI Official Synonym Full Names
ankyrin repeat domain 13A
NCBI Official Symbol
ANKRD13A
NCBI Official Synonym Symbols
ANKRD13; NY-REN-25
NCBI Protein Information
ankyrin repeat domain-containing protein 13A
UniProt Protein Name
Ankyrin repeat domain-containing protein 13A
Protein Family
UniProt Gene Name
ANKRD13A
UniProt Synonym Gene Names
ANKRD13
UniProt Entry Name
AN13A_HUMAN
Uniprot Description
ANKRD13: Ubiquitin-binding protein that specifically recognizes and binds 'Lys-63'-linked ubiquitin. Does not bind 'Lys-48'-linked ubiquitin. Positively regulates the internalization of ligand- activated EGFR by binding to the Ub moiety of ubiquitinated EGFR at the cell membrane. Interacts (via the UIM 3 and 4 repeats) with EGFR (ubiquitinated); the interaction is direct, inhibited by ANKRD13A monoubiquitination and may regulate EGFR internalization
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 12q24.11
Cellular Component: plasma membrane
Research Articles on ANKRD13A
Similar Products
Product Notes
The ANKRD13A ankrd13a (Catalog #AAA1272957) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcctcgg cctgcgacgc gggcgaccac taccccctgc acctcctagt ctggaaaaac gactaccggc agctcgagaa ggagctgcag ggccagaatg tggaggctgt ggacccacga ggtcgaacat tattgcatct tgctgtttcc ttgggacatt tggaatctgc tcgagtctta ctccgacata aagcagatgt gacaaaagaa aatcgccagg gatggacagt tttacatgag gctgtgagca ctggcgatcc tgagatggtg tacacagttc tccaacatcg agactaccac aacacatcca tggcccttga gggagttcct gagctgctcc aaaaaattct cgaggctccg gatttctatg tgcagatgaa atgggaattc accagctggg tgcccttggt ttctagaata tgcccgaatg atgtctgtcg catctggaaa agtggtgcca aactgcgcgt cgatatcaca ttgctgggat ttgaaaacat gagctggata agagggaggc gtagttttat atttaaggga gaagacaact gggcggagtt aatggaagtc aaccatgatg acaaagtggt caccaccgaa cgcttcgacc tttcccaaga aatggagcgc ctcactctgg acttgatgaa gccaaaaagc agggaagttg agcggcggct cacaagccct gtcattaaca ccagcctcga tactaaaaat attgcttttg aaagggtttt cagagttctc aagctaactc ttttgcaact gacagtgtgt agctga. It is sometimes possible for the material contained within the vial of "ANKRD13A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
