Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKMY2 cdna clone

ANKMY2 cDNA Clone

Gene Names
ANKMY2; ZMYND20
Synonyms
ANKMY2; ANKMY2 cDNA Clone; ANKMY2 cdna clone
Ordering
For Research Use Only!
Sequence
atggttcacataaagaaaggcgagctgacccaggaggagaaggagctactggaagtcatcgggaaaggtactgtccaagaagctggaacattattatccagcaagaatgttcgtgtcaactgtttggacgagaatggaatgactcctctaatgcatgcagcatataaaggaaaactcgatatgtgcaaattactactgcgacatggagccgatgtaaattgtcatcagcatgaacatggatacacagccctcatgtttgctgcactttctggtaataaagacatcacatgggtaatgttagaagctggtgctgagacagatgttgtcaactctgtgggaagaacagcagctcagatggcagcctttgtgggtcaacatgattgtgtgaccataatcaacaatttctttcctcgagagagactggattattacactaagccccagggactggataaagagccaaaactgcccccaaagttggcaggcccgctgcacaaaattatcaccacaacgaatcttcatcctgtcaagatcgtgatgcttgtaaatgagaatcctctgctgacagaagaagcagccctgaataaatgctacagagtgatggatttgatttgtgagaaatgtatgaagcaaagagacatgaatgaagtattggctatgaagatgcattacataagctgtatctttcagaaatgcattaacttcttaaaagatggagagaataaactggacaccttgatcaaaagcttgttaaaaggccgagcttctgatggctttccagtgtatcaagaaaagatcattagagaaagtatcagaaaatttccttactgtgaagctacactcctccagcagctggttcgaagcattgctcctgttgaaattggttctgatcccactgcattctccgtccttacccaagccatcactggccaggtgggttttgtggatgtggaattttgcactacctgtggagaaaagggagcaagtaaaagatgttcagtttgcaaaatggtaatatattgtgatcaaacctgccagaaaacacactggtttactcataagaaaatctgtaagaatctgaaggacatttacgaaaagcaacagttggaggctgccaaagaaaagagacaagaggaaaaccacggcaaacttgatgtcaattctaactgtgttaatgaagagcaaccagaggctgaagtaggtatctctcaaaaggattctaatcctgaagattccggggaaggaaagaaagaatctcttgaaagcgaagctgagttggaaggcttacaggatgctcctgcagggccacaggtgtctgaggagtaa
Sequence Length
1326
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,299 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and MYND domain containing 2, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and MYND domain containing 2
NCBI Official Symbol
ANKMY2
NCBI Official Synonym Symbols
ZMYND20
NCBI Protein Information
ankyrin repeat and MYND domain-containing protein 2
UniProt Protein Name
Ankyrin repeat and MYND domain-containing protein 2
UniProt Gene Name
ANKMY2
UniProt Entry Name
ANKY2_HUMAN

Uniprot Description

ANKMY2: May be involved in the trafficking of signaling proteins to the cilia.

Chromosomal Location of Human Ortholog: 7p21

Molecular Function: protein binding

Similar Products

Product Notes

The ANKMY2 ankmy2 (Catalog #AAA1270012) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttcaca taaagaaagg cgagctgacc caggaggaga aggagctact ggaagtcatc gggaaaggta ctgtccaaga agctggaaca ttattatcca gcaagaatgt tcgtgtcaac tgtttggacg agaatggaat gactcctcta atgcatgcag catataaagg aaaactcgat atgtgcaaat tactactgcg acatggagcc gatgtaaatt gtcatcagca tgaacatgga tacacagccc tcatgtttgc tgcactttct ggtaataaag acatcacatg ggtaatgtta gaagctggtg ctgagacaga tgttgtcaac tctgtgggaa gaacagcagc tcagatggca gcctttgtgg gtcaacatga ttgtgtgacc ataatcaaca atttctttcc tcgagagaga ctggattatt acactaagcc ccagggactg gataaagagc caaaactgcc cccaaagttg gcaggcccgc tgcacaaaat tatcaccaca acgaatcttc atcctgtcaa gatcgtgatg cttgtaaatg agaatcctct gctgacagaa gaagcagccc tgaataaatg ctacagagtg atggatttga tttgtgagaa atgtatgaag caaagagaca tgaatgaagt attggctatg aagatgcatt acataagctg tatctttcag aaatgcatta acttcttaaa agatggagag aataaactgg acaccttgat caaaagcttg ttaaaaggcc gagcttctga tggctttcca gtgtatcaag aaaagatcat tagagaaagt atcagaaaat ttccttactg tgaagctaca ctcctccagc agctggttcg aagcattgct cctgttgaaa ttggttctga tcccactgca ttctccgtcc ttacccaagc catcactggc caggtgggtt ttgtggatgt ggaattttgc actacctgtg gagaaaaggg agcaagtaaa agatgttcag tttgcaaaat ggtaatatat tgtgatcaaa cctgccagaa aacacactgg tttactcata agaaaatctg taagaatctg aaggacattt acgaaaagca acagttggag gctgccaaag aaaagagaca agaggaaaac cacggcaaac ttgatgtcaa ttctaactgt gttaatgaag agcaaccaga ggctgaagta ggtatctctc aaaaggattc taatcctgaa gattccgggg aaggaaagaa agaatctctt gaaagcgaag ctgagttgga aggcttacag gatgctcctg cagggccaca ggtgtctgag gagtaa. It is sometimes possible for the material contained within the vial of "ANKMY2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.