AMDHD1 cdna clone
AMDHD1 cDNA Clone
Gene Names
AMDHD1; HMFT1272
Synonyms
AMDHD1; AMDHD1 cDNA Clone; AMDHD1 cdna clone
Sequence
atggcaggcggccacagcctcctgctggagaacgcgcagcaagtggtgttggtgtgcgcccgcggcgagcgcttcctggcgcgggatgcgctgcgcagcctggcggtgctggaaggcgccagtctggtggtgggcaaagatggatttataaaagctattggtcctgctgatgttattcaaagacagttttctggagaaacttttgaagaaataattgactgctctgggaaatgtatcctaccaggtttggtggatgcacacacacatccagtatgggctggtgaaagagttcacgaatttgcaatgaagttggcaggagccacctacatggaaattcaccaggccggaggagggatccactttaccgtggagcgcacgcgccaagccacagaggaggagctgttccgctccttgcagcaacggctccagtgcatgatgagggctggcaccacgctggtggagtgcaagagtggatatggcctcgacctggagaccgagctcaagatgctgcgcgtgattgagcgcgcccggcgggagctggacatcggcatctcggctacctactgcggggctcattcagtgcctaaaggaaaaactgctactgaagctgctgatgacatcatcaataaccacctcccaaagctgaaggaacttggcagaaatggggaaatacacgtggacaatatagacgtattttgtgagaaaggtgtctttgatctcgattccaccagaaggattcttcaacgtggaaaagatatagggttacagattaacttccatggggatgaactccacccgatgaaggctgctgagcttggggctgaactgggagcgcaggcaatcagccacctggaagaagtgagtgatgaaggcatcgttgccatggcaacggccaggtgctctgccatccttctgcccaccacagcctacatgctgagactgaaacaacctcgagccaggaagatgttagatgaaggagtaatagttgctctgggaagtgatttcaaccccaatgcatattgcttttcaatgccaatggtcatgcatctggcctgtgtaaacatgagaatgtccatgcctgaggccttggccgctgccaccatcaatgcagcttatgcactgggaaagtctcacacacacggatcgttggaagttggcaaacagggagatctcattatcatcaattcatcccgatgggagcatttgatttaccagttcggaggccatcatgaattaattgaatatgttatagctaaaggaaaactcatctataaaacatga
Sequence Length
1281
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,743 Da
NCBI Official Full Name
Homo sapiens amidohydrolase domain containing 1, mRNA
NCBI Official Synonym Full Names
amidohydrolase domain containing 1
NCBI Official Symbol
AMDHD1
NCBI Official Synonym Symbols
HMFT1272
NCBI Protein Information
probable imidazolonepropionase
UniProt Protein Name
Probable imidazolonepropionase
Protein Family
UniProt Gene Name
AMDHD1
UniProt Entry Name
HUTI_HUMAN
Uniprot Description
AMDHD1: Belongs to the HutI family.
Protein type: Hydrolase; Amino Acid Metabolism - histidine; EC 3.5.2.7
Chromosomal Location of Human Ortholog: 12q23.1
Cellular Component: cytosol
Molecular Function: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides
Biological Process: histidine catabolic process
Research Articles on AMDHD1
Similar Products
Product Notes
The AMDHD1 amdhd1 (Catalog #AAA1266920) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggcg gccacagcct cctgctggag aacgcgcagc aagtggtgtt ggtgtgcgcc cgcggcgagc gcttcctggc gcgggatgcg ctgcgcagcc tggcggtgct ggaaggcgcc agtctggtgg tgggcaaaga tggatttata aaagctattg gtcctgctga tgttattcaa agacagtttt ctggagaaac ttttgaagaa ataattgact gctctgggaa atgtatccta ccaggtttgg tggatgcaca cacacatcca gtatgggctg gtgaaagagt tcacgaattt gcaatgaagt tggcaggagc cacctacatg gaaattcacc aggccggagg agggatccac tttaccgtgg agcgcacgcg ccaagccaca gaggaggagc tgttccgctc cttgcagcaa cggctccagt gcatgatgag ggctggcacc acgctggtgg agtgcaagag tggatatggc ctcgacctgg agaccgagct caagatgctg cgcgtgattg agcgcgcccg gcgggagctg gacatcggca tctcggctac ctactgcggg gctcattcag tgcctaaagg aaaaactgct actgaagctg ctgatgacat catcaataac cacctcccaa agctgaagga acttggcaga aatggggaaa tacacgtgga caatatagac gtattttgtg agaaaggtgt ctttgatctc gattccacca gaaggattct tcaacgtgga aaagatatag ggttacagat taacttccat ggggatgaac tccacccgat gaaggctgct gagcttgggg ctgaactggg agcgcaggca atcagccacc tggaagaagt gagtgatgaa ggcatcgttg ccatggcaac ggccaggtgc tctgccatcc ttctgcccac cacagcctac atgctgagac tgaaacaacc tcgagccagg aagatgttag atgaaggagt aatagttgct ctgggaagtg atttcaaccc caatgcatat tgcttttcaa tgccaatggt catgcatctg gcctgtgtaa acatgagaat gtccatgcct gaggccttgg ccgctgccac catcaatgca gcttatgcac tgggaaagtc tcacacacac ggatcgttgg aagttggcaa acagggagat ctcattatca tcaattcatc ccgatgggag catttgattt accagttcgg aggccatcat gaattaattg aatatgttat agctaaagga aaactcatct ataaaacatg a. It is sometimes possible for the material contained within the vial of "AMDHD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
