Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALKBH2 cdna clone

ALKBH2 cDNA Clone

Gene Names
ALKBH2; ABH2
Synonyms
ALKBH2; ALKBH2 cDNA Clone; ALKBH2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacagattcctggtgaaaggggctcaagggggccttttgaggaagcaggaggagcaagagccaactggagaagagccagctgtgttgggaggagacaaagaaagcacaaggaagaggcccaggagagaggccccagggaatggaggccactcagcaggccctagctggcggcacattcgggctgagggcctggactgcagttacacagtcctgtttggcaaagctgaggcagatgagattttccaagagttggagaaagaagtagaatattttacaggagcactggccagagtccaggtattcgggaagtggcacagtgtgcccaggaagcaggcaacgtatggcgacgctgggctgacctacacattttcaggcctcacgctgtctccaaagccctggatcccagttctagagcgcatccgggatcacgtctctggggtgactggacagaccttcaactttgtgctcatcaacaggtataaagatggctgtgaccacatcggggagcaccgagatgatgaaagagaactggcccctgggagccccattgcctctgtctccttcggtgcctgcagagactttgtcttccggcataaggattcccgtgggaaaagcccctccaggagggtggcggtggtcaggctgccgctggcccacgggagcttactaatgatgaaccacccgaccaacacgcactggtaccacagtcttcccgtgagaaagaaggttctggctccacgggtgaatctgacttttcgtaaaattttgcttactaaaaaataa
Sequence Length
786
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,083 Da
NCBI Official Full Name
Homo sapiens alkB, alkylation repair homolog 2 (E. coli), mRNA
NCBI Official Synonym Full Names
alkB homolog 2, alpha-ketoglutarate dependent dioxygenase
NCBI Official Symbol
ALKBH2
NCBI Official Synonym Symbols
ABH2
NCBI Protein Information
DNA oxidative demethylase ALKBH2
UniProt Protein Name
DNA oxidative demethylase ALKBH2
Protein Family
UniProt Gene Name
ALKBH2
UniProt Synonym Gene Names
ABH2
UniProt Entry Name
ALKB2_HUMAN

NCBI Description

The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]

Uniprot Description

ALKBH2: Dioxygenase that repairs alkylated DNA and RNA containing 1-methyladenine and 3-methylcytosine by oxidative demethylation. Can also repair alkylated DNA containing 1- ethenoadenine (in vitro). Has strong preference for double- stranded DNA. Has low efficiency with single-stranded substrates. Requires molecular oxygen, alpha-ketoglutarate and iron. Belongs to the alkB family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 1.14.11.33; Demethylase; DNA repair, damage; Oxidoreductase

Chromosomal Location of Human Ortholog: 12q24.11

Cellular Component: microtubule cytoskeleton; nucleoplasm; nucleus

Molecular Function: DNA demethylase activity; DNA-N1-methyladenine dioxygenase activity; ferrous iron binding

Biological Process: DNA dealkylation

Research Articles on ALKBH2

Similar Products

Product Notes

The ALKBH2 alkbh2 (Catalog #AAA1271596) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagat tcctggtgaa aggggctcaa gggggccttt tgaggaagca ggaggagcaa gagccaactg gagaagagcc agctgtgttg ggaggagaca aagaaagcac aaggaagagg cccaggagag aggccccagg gaatggaggc cactcagcag gccctagctg gcggcacatt cgggctgagg gcctggactg cagttacaca gtcctgtttg gcaaagctga ggcagatgag attttccaag agttggagaa agaagtagaa tattttacag gagcactggc cagagtccag gtattcggga agtggcacag tgtgcccagg aagcaggcaa cgtatggcga cgctgggctg acctacacat tttcaggcct cacgctgtct ccaaagccct ggatcccagt tctagagcgc atccgggatc acgtctctgg ggtgactgga cagaccttca actttgtgct catcaacagg tataaagatg gctgtgacca catcggggag caccgagatg atgaaagaga actggcccct gggagcccca ttgcctctgt ctccttcggt gcctgcagag actttgtctt ccggcataag gattcccgtg ggaaaagccc ctccaggagg gtggcggtgg tcaggctgcc gctggcccac gggagcttac taatgatgaa ccacccgacc aacacgcact ggtaccacag tcttcccgtg agaaagaagg ttctggctcc acgggtgaat ctgacttttc gtaaaatttt gcttactaaa aaataa. It is sometimes possible for the material contained within the vial of "ALKBH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.