Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALG3 cdna clone

ALG3 cDNA Clone

Gene Names
ALG3; not; CDG1D; CDGS4; CDGS6; Not56; NOT56L; D16Ertd36e
Synonyms
ALG3; ALG3 cDNA Clone; ALG3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggctgggctgcggaaacgcggccggtccggttccgcggcccaggcagagggactctgcaagcaatggctgcagcgcgcctggcaagagcggcgcctgctgctgcgggagccgcgctacacgctgctggtggccgcctgcctctgcctggcggaggtgggcatcaccttctgggtcattcacagggtggcatacacagagattgactggaaggcctacatggccgaggtagaaggcgtcatcaatggtacctatgactatacccaactgcagggtgacaccggaccacttgtgtacccagctggtttcgtgtacatctttatggggttgtactatgccaccagccgaggcactgacatccgcatggcccagaacatctttgctgtgctctacctggctaccttgctgcttgtcttcttgatctatcaccagacctgcaaggtacctcccttcgtctttttcttcatgtgctgcgcctcttaccgtgtccactccatctttgtgctgcggctcttcaatgacccagtggccatggtgctgctcttcctcagtatcaacctcctgctggcccagcgctggggctggggttgctgctttttcagcctggcagtctctgtgaagatgaatgtgctgctcttcgcccctgggttactgtttcttctcctcacacagtttggcttccgtggggccctccccaagctgggaatctgtgctggccttcaggtggtgctggggctgcccttcctgctggagaaccccagcggctacctgtcccgctcctttgaccttggccgccagtttctgttccactggacagtgaactggcgcttcctcccagaggcgctcttcctgcatcgagccttccacctggccctgttgactgcccacctcaccctgctcctgctgtttgccctctgcaggtggcacaggacaggggaaagtatcttgtcgctgctgagggatccctccaaaaggaaggttccaccccagccccttacacccaaccagatcgtttctaccctcttcacctccaacttcattggcatctgcttcagccgctccctccactaccagttctacgtctggtatttccacacactgccctacctcctgtgggccatgcctgcacgctggctcacacacctgctcaggttgttggtgctggggctcatcgagctctcctggaacacatacccttccacatcctgcagctctgctgccctgcacatatgccatgccgtcatcctgctgcagctctggctgggcccgcagcctttccccaagagcacccaacacagcaagaaagcccactga
Sequence Length
1317
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,370 Da
NCBI Official Full Name
Homo sapiens asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
ALG3, alpha-1,3- mannosyltransferase
NCBI Official Symbol
ALG3
NCBI Official Synonym Symbols
not; CDG1D; CDGS4; CDGS6; Not56; NOT56L; D16Ertd36e
NCBI Protein Information
dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase
UniProt Protein Name
Dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase
UniProt Gene Name
ALG3
UniProt Synonym Gene Names
NOT; NOT56L
UniProt Entry Name
ALG3_HUMAN

NCBI Description

This gene encodes a member of the ALG3 family. The encoded protein catalyses the addition of the first dol-P-Man derived mannose in an alpha 1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in this gene have been associated with congenital disorder of glycosylation type Id (CDG-Id) characterized by abnormal N-glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]

Uniprot Description

ALG3: Adds the first Dol-P-Man derived mannose in an alpha-1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in ALG3 are the cause of congenital disorder of glycosylation type 1D (CDG1D); also known as carbohydrate-deficient glycoprotein syndrome type IV (CDGS4). CDGs are metabolic deficiencies in glycoprotein biosynthesis that usually cause severe mental and psychomotor retardation. They are characterized by under-glycosylated serum glycoproteins. Belongs to the glycosyltransferase 58 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Endoplasmic reticulum; Transferase; Membrane protein, integral; Glycan Metabolism - N-glycan biosynthesis; Membrane protein, multi-pass; EC 2.4.1.258

Chromosomal Location of Human Ortholog: 3q27.1

Cellular Component: endoplasmic reticulum membrane

Molecular Function: alpha-1,3-mannosyltransferase activity

Biological Process: dolichol-linked oligosaccharide biosynthetic process

Disease: Congenital Disorder Of Glycosylation, Type Id

Research Articles on ALG3

Similar Products

Product Notes

The ALG3 alg3 (Catalog #AAA1265912) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg ggctgcggaa acgcggccgg tccggttccg cggcccaggc agagggactc tgcaagcaat ggctgcagcg cgcctggcaa gagcggcgcc tgctgctgcg ggagccgcgc tacacgctgc tggtggccgc ctgcctctgc ctggcggagg tgggcatcac cttctgggtc attcacaggg tggcatacac agagattgac tggaaggcct acatggccga ggtagaaggc gtcatcaatg gtacctatga ctatacccaa ctgcagggtg acaccggacc acttgtgtac ccagctggtt tcgtgtacat ctttatgggg ttgtactatg ccaccagccg aggcactgac atccgcatgg cccagaacat ctttgctgtg ctctacctgg ctaccttgct gcttgtcttc ttgatctatc accagacctg caaggtacct cccttcgtct ttttcttcat gtgctgcgcc tcttaccgtg tccactccat ctttgtgctg cggctcttca atgacccagt ggccatggtg ctgctcttcc tcagtatcaa cctcctgctg gcccagcgct ggggctgggg ttgctgcttt ttcagcctgg cagtctctgt gaagatgaat gtgctgctct tcgcccctgg gttactgttt cttctcctca cacagtttgg cttccgtggg gccctcccca agctgggaat ctgtgctggc cttcaggtgg tgctggggct gcccttcctg ctggagaacc ccagcggcta cctgtcccgc tcctttgacc ttggccgcca gtttctgttc cactggacag tgaactggcg cttcctccca gaggcgctct tcctgcatcg agccttccac ctggccctgt tgactgccca cctcaccctg ctcctgctgt ttgccctctg caggtggcac aggacagggg aaagtatctt gtcgctgctg agggatccct ccaaaaggaa ggttccaccc cagcccctta cacccaacca gatcgtttct accctcttca cctccaactt cattggcatc tgcttcagcc gctccctcca ctaccagttc tacgtctggt atttccacac actgccctac ctcctgtggg ccatgcctgc acgctggctc acacacctgc tcaggttgtt ggtgctgggg ctcatcgagc tctcctggaa cacataccct tccacatcct gcagctctgc tgccctgcac atatgccatg ccgtcatcct gctgcagctc tggctgggcc cgcagccttt ccccaagagc acccaacaca gcaagaaagc ccactga. It is sometimes possible for the material contained within the vial of "ALG3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.