Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALG1 cdna clone

ALG1 cDNA Clone

Gene Names
ALG1; HMT1; MT-1; CDG1K; HMAT1; HMT-1; Mat-1; hMat-1
Synonyms
ALG1; ALG1 cDNA Clone; ALG1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcctcatgcttggtcctgctggcgctgtgtctgctgctgccgctgctgctgctgggaggatggaagcgctggcgccgggggcgggcggcccggcatgtagtagcggtggtgctgggcgacgtgggccgcagcccccgtatgcagtaccacgcgctgtcgttggccatgcacggcttctcggtgaccctcctggggttctgcaactccaaaccccatgatgagctcttgcagaacaacagaattcagattgtggggttgacagaacttcagagtcttgcagttgggccccgagttttccagtacggagtcaaagttgtacttcaggctatgtacttgctgtggaagttgatgtggagggagccaggtgcctatatctttctccagaaccccccaggtctgcctagcattgctgtctgctggttcgtgggctgcctttgtggaagcaagctcgtcattgactggcacaactatggctactccatcatgggtctggtgcatggccccaaccatcccctcgttctgctggccaagtggtacgagaagttctttgggcgcctgtcccacctgaacctgtgtgttaccaatgctatgcgagaagacctggcggataactggcacatcagggctgtgaccgtctacgacaagcccgcatctttctttaaagagacacctctggacctgcagcaccggctcttcatgaagctgggcagcatgcactctccgttcagggcccgctcagaacctgaggacccagtcacggagcggtcggccttcacggagcgggatgctgggaacgggctggtgacgcgtctccgtgagcggccagccctgctggtcagcagcacgagctggacagaggacgaagacttctccatcctgctggcagctttagaaaagtttgaacaactgactcttgatggacacaaccttccttctctcgtctgtgtgataacaggcaaagggcctctgagggagtattatagccgcctcatccaccagaagcacttccagcacatccaggtctgcaccccctggctggaggccgaggactaccccctgcttctagggtcggcggacctgggtgtctgtctgcacacgtcctccagtggcctggacctgcccatgaaggtggtggacatgttcgggtgctgtttgcctgtgtgtgctgtgaacttcaagtgtttacatgagctggtgaaacatgaagaaaatggcctggtctttgaggactcagaggaactggcagctcagctgcagatgcttttctcaaactttcctgatcctgcgggcaagctaaaccagttccggaagaacctgcgggagtcgcagcagctccgatgggatgagagctgggtgcagactgtgctccctttggttatggacacataa
Sequence Length
1395
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,338 Da
NCBI Official Full Name
Homo sapiens asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
NCBI Official Symbol
ALG1
NCBI Official Synonym Symbols
HMT1; MT-1; CDG1K; HMAT1; HMT-1; Mat-1; hMat-1
NCBI Protein Information
chitobiosyldiphosphodolichol beta-mannosyltransferase
UniProt Protein Name
Chitobiosyldiphosphodolichol beta-mannosyltransferase
UniProt Gene Name
ALG1
UniProt Synonym Gene Names
HMAT1; HMT1; MT-1; hMat-1
UniProt Entry Name
ALG1_HUMAN

NCBI Description

The enzyme encoded by this gene catalyzes the first mannosylation step in the biosynthesis of lipid-linked oligosaccharides. This gene is mutated in congenital disorder of glycosylation type Ik. [provided by RefSeq, Dec 2008]

Uniprot Description

ALG1: Participates in the formation of the lipid-linked precursor oligosaccharide for N-glycosylation. Involved in assembling the dolichol-pyrophosphate-GlcNAc(2)-Man(5) intermediate on the cytoplasmic surface of the ER. Defects in ALG1 are the cause of congenital disorder of glycosylation type 1K (CDG1K). CDGs are a family of severe inherited diseases caused by a defect in protein N- glycosylation. They are characterized by under-glycosylated serum proteins. These multisystem disorders present with a wide variety of clinical features, such as disorders of the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. Belongs to the glycosyltransferase group 1 family. Glycosyltransferase 33 subfamily.

Protein type: Glycan Metabolism - N-glycan biosynthesis; Membrane protein, integral; Transferase; Endoplasmic reticulum; EC 2.4.1.142

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane

Molecular Function: chitobiosyldiphosphodolichol beta-mannosyltransferase activity; mannosyltransferase activity

Biological Process: dolichol-linked oligosaccharide biosynthetic process; lipopolysaccharide biosynthetic process

Disease: Congenital Disorder Of Glycosylation, Type Ik

Research Articles on ALG1

Similar Products

Product Notes

The ALG1 alg1 (Catalog #AAA1277964) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcct catgcttggt cctgctggcg ctgtgtctgc tgctgccgct gctgctgctg ggaggatgga agcgctggcg ccgggggcgg gcggcccggc atgtagtagc ggtggtgctg ggcgacgtgg gccgcagccc ccgtatgcag taccacgcgc tgtcgttggc catgcacggc ttctcggtga ccctcctggg gttctgcaac tccaaacccc atgatgagct cttgcagaac aacagaattc agattgtggg gttgacagaa cttcagagtc ttgcagttgg gccccgagtt ttccagtacg gagtcaaagt tgtacttcag gctatgtact tgctgtggaa gttgatgtgg agggagccag gtgcctatat ctttctccag aaccccccag gtctgcctag cattgctgtc tgctggttcg tgggctgcct ttgtggaagc aagctcgtca ttgactggca caactatggc tactccatca tgggtctggt gcatggcccc aaccatcccc tcgttctgct ggccaagtgg tacgagaagt tctttgggcg cctgtcccac ctgaacctgt gtgttaccaa tgctatgcga gaagacctgg cggataactg gcacatcagg gctgtgaccg tctacgacaa gcccgcatct ttctttaaag agacacctct ggacctgcag caccggctct tcatgaagct gggcagcatg cactctccgt tcagggcccg ctcagaacct gaggacccag tcacggagcg gtcggccttc acggagcggg atgctgggaa cgggctggtg acgcgtctcc gtgagcggcc agccctgctg gtcagcagca cgagctggac agaggacgaa gacttctcca tcctgctggc agctttagaa aagtttgaac aactgactct tgatggacac aaccttcctt ctctcgtctg tgtgataaca ggcaaagggc ctctgaggga gtattatagc cgcctcatcc accagaagca cttccagcac atccaggtct gcaccccctg gctggaggcc gaggactacc ccctgcttct agggtcggcg gacctgggtg tctgtctgca cacgtcctcc agtggcctgg acctgcccat gaaggtggtg gacatgttcg ggtgctgttt gcctgtgtgt gctgtgaact tcaagtgttt acatgagctg gtgaaacatg aagaaaatgg cctggtcttt gaggactcag aggaactggc agctcagctg cagatgcttt tctcaaactt tcctgatcct gcgggcaagc taaaccagtt ccggaagaac ctgcgggagt cgcagcagct ccgatgggat gagagctggg tgcagactgt gctccctttg gttatggaca cataa. It is sometimes possible for the material contained within the vial of "ALG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.