Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AKAP3 cdna clone

AKAP3 cDNA Clone

Gene Names
AKAP3; CT82; SOB1; FSP95; PRKA3; HEL159; AKAP110; AKAP 110
Synonyms
AKAP3; AKAP3 cDNA Clone; AKAP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagaaaaggttgactggttacaaagccaaaatggagtatgcaaagttgatgtctattctcctggagacaaccaagcccaggactggaaaatggacacctccacggatcctgtcagagtgctcagctggctccgcagagacctggagaagagtacagcagagttccaagatgttcggttcaaacccggagaatcatttggtggggaaacgtccaactcaggagacccacacaaaggtttctctgtagactattacaacaccaccaccaagggcactccagaaagattgcattttgagatgactcacaaagagattccttgccagggccccagggcccaacttggcaacgagagttcagtagatgaagtttccttctatgctaaccgcctcacgaatctagtcatagccatggcccgcaaagagatcaatgagaagatcgatggctctgaaaacaaatgtgtctatcagtcattgtacatggggaatgaacccacacccaccaaaagcctcagtaagatagcatcagagcttgtgaatgagaccgtctctgcatgttccaggaatgctgccccagacaaggctcctggctctggagacagagtctcaggatcatcacaaagtcccccaaatttgaaatacaagtccactttgaagatcaaggagagcaccaaagaaagacagggtccagatgacaagcctccttctaagaagtctttcttctataaggaagtgtttgaatctcgtaacggagattatgccagagagggtggaaggttctttcctcgggagagaaagaggtttcgagggcaggaaaggcctgatgactttacggcttctgttagtgaagggatcatgacctatgctaacagtgtggtatctgatatgatggtctccatcatgaagacactgaagatccaagtgaaagacacaaccattgccaccatcctactgaagaaggttctgctcaagcatgcaaaagaggtggtctcggatctcatcgactccttcttgaggaatctccacagcgtcacagggaccctcatgactgacacacagtttgtctcggctgtgaaaagaactgtcttctctcatggaagccaaaaggccacagatatcatggatgccatgctaaggaagctgtacaatgtaatgtttgccaagaaagtccctgagcatgtcaggaaagcccaagacaaggctgagagttattccctcatctccatgaaaggaatgggtgatcctaaaaaccgaaatgtgaactttgccatgaaatctgaaactaaattgagagaaaaaatgtattctgaacccaaatcagaggaggagacttgtgcgaaaactctgggtgagcacattatcaaagaggggcttaccctgtggcataaaagtcagcagaaagaatgtaaatctctaggtttccagcatgcagcattcgaagctcccaacacacagcgtaagcctgcatcagacatttcctttgagtaccctgaagatattggcaacctcagccttcctccatatcctccagagaaacctgagaattttatgtatgattcagactcctgggccaaggacctgatcgtgtctgccctgcttctgattcaatatcacctggcccagggaggaagaagggatgcacggagcttcgttgaagctgctggcaccaccaactttcctgccaatgaacctcctgtagctcccgatgaatcttgccttaagtctgctcccattgtaggtgaccaagaacaagcagaaaagaaggacctaaggagtgttttctttaatttcatccggaacttacttagtgagaccattttcaagcgtgaccagagccctgaacccaaggtgccggaacagccagttaaggaagataggaagttgtgtgaaagaccgttggcgtcttctccccccaggctatatgaggatgatgagacccctggtgccctttctgggctgaccaagatggctgtcagccagatagatggccacatgagtgggcagatggtagaacatctgatgaactcagtgatgaagctgtgtgtcatcattgctaagtcctgtgatgcttcgttggcagagctgggagatgacaagtctggagatgccagtaggctaacttcggccttcccagatagtttatatgagtgcttaccagccaagggcacagggtcagcagaagctgtcctgcagaatgcctatcaagctatccataatgaaatgagaggcacatcaggacagccccctgaagggtgtgcagcacccacggtgattgtcagcaatcacaacctaacggacacagttcagaacaagcaactccaagccgtcctccaatgggtagctgcctctgagctcaatgtccctattttgtattttgctggtgatgatgaagggatccaggagaagctacttcagctctcagctgctgctgtggacaaaggatgcagtgtgggcgaggttctgcagtcggtgctgcgctatgagaaggagcgccagctgaatgaggcggtggggaatgtcacaccgctgcagctgctggactggctgatggtgaacctgtaa
Sequence Length
2562
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
94,751 Da
NCBI Official Full Name
Homo sapiens A kinase (PRKA) anchor protein 3, mRNA
NCBI Official Synonym Full Names
A-kinase anchoring protein 3
NCBI Official Symbol
AKAP3
NCBI Official Synonym Symbols
CT82; SOB1; FSP95; PRKA3; HEL159; AKAP110; AKAP 110
NCBI Protein Information
A-kinase anchor protein 3
UniProt Protein Name
A-kinase anchor protein 3
Protein Family
UniProt Gene Name
AKAP3
UniProt Synonym Gene Names
AKAP110; SOB1; AKAP-3; AKAP 110; CT82; FSP95; PRKA3
UniProt Entry Name
AKAP3_HUMAN

NCBI Description

This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is reported to participate in protein-protein interactions with the R-subunit of the protein kinase A as well as sperm-associated proteins. This protein is expressed in spermatozoa and localized to the acrosomal region of the sperm head as well as the length of the principal piece. It may function as a regulator of motility, capacitation, and the acrosome reaction. [provided by RefSeq, May 2013]

Uniprot Description

AKAP3: May function as a regulator of both motility- and head- associated functions such as capacitation and the acrosome reaction. Belongs to the AKAP110 family.

Protein type: Adaptor/scaffold; Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: 12p13.3

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding

Biological Process: acrosome reaction; cell motility; single fertilization

Research Articles on AKAP3

Similar Products

Product Notes

The AKAP3 akap3 (Catalog #AAA1269511) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagaaa aggttgactg gttacaaagc caaaatggag tatgcaaagt tgatgtctat tctcctggag acaaccaagc ccaggactgg aaaatggaca cctccacgga tcctgtcaga gtgctcagct ggctccgcag agacctggag aagagtacag cagagttcca agatgttcgg ttcaaacccg gagaatcatt tggtggggaa acgtccaact caggagaccc acacaaaggt ttctctgtag actattacaa caccaccacc aagggcactc cagaaagatt gcattttgag atgactcaca aagagattcc ttgccagggc cccagggccc aacttggcaa cgagagttca gtagatgaag tttccttcta tgctaaccgc ctcacgaatc tagtcatagc catggcccgc aaagagatca atgagaagat cgatggctct gaaaacaaat gtgtctatca gtcattgtac atggggaatg aacccacacc caccaaaagc ctcagtaaga tagcatcaga gcttgtgaat gagaccgtct ctgcatgttc caggaatgct gccccagaca aggctcctgg ctctggagac agagtctcag gatcatcaca aagtccccca aatttgaaat acaagtccac tttgaagatc aaggagagca ccaaagaaag acagggtcca gatgacaagc ctccttctaa gaagtctttc ttctataagg aagtgtttga atctcgtaac ggagattatg ccagagaggg tggaaggttc tttcctcggg agagaaagag gtttcgaggg caggaaaggc ctgatgactt tacggcttct gttagtgaag ggatcatgac ctatgctaac agtgtggtat ctgatatgat ggtctccatc atgaagacac tgaagatcca agtgaaagac acaaccattg ccaccatcct actgaagaag gttctgctca agcatgcaaa agaggtggtc tcggatctca tcgactcctt cttgaggaat ctccacagcg tcacagggac cctcatgact gacacacagt ttgtctcggc tgtgaaaaga actgtcttct ctcatggaag ccaaaaggcc acagatatca tggatgccat gctaaggaag ctgtacaatg taatgtttgc caagaaagtc cctgagcatg tcaggaaagc ccaagacaag gctgagagtt attccctcat ctccatgaaa ggaatgggtg atcctaaaaa ccgaaatgtg aactttgcca tgaaatctga aactaaattg agagaaaaaa tgtattctga acccaaatca gaggaggaga cttgtgcgaa aactctgggt gagcacatta tcaaagaggg gcttaccctg tggcataaaa gtcagcagaa agaatgtaaa tctctaggtt tccagcatgc agcattcgaa gctcccaaca cacagcgtaa gcctgcatca gacatttcct ttgagtaccc tgaagatatt ggcaacctca gccttcctcc atatcctcca gagaaacctg agaattttat gtatgattca gactcctggg ccaaggacct gatcgtgtct gccctgcttc tgattcaata tcacctggcc cagggaggaa gaagggatgc acggagcttc gttgaagctg ctggcaccac caactttcct gccaatgaac ctcctgtagc tcccgatgaa tcttgcctta agtctgctcc cattgtaggt gaccaagaac aagcagaaaa gaaggaccta aggagtgttt tctttaattt catccggaac ttacttagtg agaccatttt caagcgtgac cagagccctg aacccaaggt gccggaacag ccagttaagg aagataggaa gttgtgtgaa agaccgttgg cgtcttctcc ccccaggcta tatgaggatg atgagacccc tggtgccctt tctgggctga ccaagatggc tgtcagccag atagatggcc acatgagtgg gcagatggta gaacatctga tgaactcagt gatgaagctg tgtgtcatca ttgctaagtc ctgtgatgct tcgttggcag agctgggaga tgacaagtct ggagatgcca gtaggctaac ttcggccttc ccagatagtt tatatgagtg cttaccagcc aagggcacag ggtcagcaga agctgtcctg cagaatgcct atcaagctat ccataatgaa atgagaggca catcaggaca gccccctgaa gggtgtgcag cacccacggt gattgtcagc aatcacaacc taacggacac agttcagaac aagcaactcc aagccgtcct ccaatgggta gctgcctctg agctcaatgt ccctattttg tattttgctg gtgatgatga agggatccag gagaagctac ttcagctctc agctgctgct gtggacaaag gatgcagtgt gggcgaggtt ctgcagtcgg tgctgcgcta tgagaaggag cgccagctga atgaggcggt ggggaatgtc acaccgctgc agctgctgga ctggctgatg gtgaacctgt aa. It is sometimes possible for the material contained within the vial of "AKAP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.