AGPAT4 cdna clone

AGPAT4 cDNA Clone

Gene Names

AGPAT4; 1-AGPAT4; dJ473J16.2; LPAAT-delta

Synonyms

AGPAT4; AGPAT4 cDNA Clone; AGPAT4 cdna clone

Ordering
Cat. Num. AAA1278185 For Research Use Only!

Sequence

atggacctcgcgggactgctgaagtctcagttcctgtgccacctggtcttctgctacgtctttattgcctcagggctaatcatcaacaccattcagctcttcactctcctcctctggcccattaacaagcagctcttccggaagatcaactgcagactgtcctattgcatctcaagccagctggtgatgctgctggagtggtggtcgggcacggaatgcaccatcttcacggacccgcgcgcctacctcaagtatgggaaggaaaatgccatcgtggttctcaaccacaagtttgaaattgactttctgtgtggctggagcctgtccgaacgctttgggctgttagggggctccaaggtcctggccaagaaagagctggcctatgtcccaattatcggctggatgtggtacttcaccgagatggtcttctgttcgcgcaagtgggagcaggatcgcaagacggttgccaccagtttgcagcacctccgggactaccccgagaagtattttttcctgattcactgtgagggcacacggttcacggagaagaagcatgagatcagcatgcaggtggcccgggccaaggggctgcctcgcctcaagcatcacctgttgccacgaaccaagggcttcgccatcaccgtgaggagcttgagaaatgtagtttcagctgtatatgactgtacactcaatttcagaaataatgaaaatccaacactgctgggagtcctaaacggaaagaaataccatgcagatttgtatgttaggaggatcccactggaagacatccctgaagacgatgacgagtgctcggcctggctgcacaagctctaccaggagaaggatgcctttcaggaggagtactacaggacgggcaccttcccagagacgcccatggtgcccccccggcggccctggaccctcgtgaactggctgttttgggcctcgctggtgctctaccctttcttccagttcctggtcagcatgatcaggagcgggtcttccctgacgctggccagcttcatcctcgtcttctttgtggcctctgtgggagttcgatggatgattggtgtgacggaaattgacaagggctctgcctacggcaactctgacagcaagcagaaactgaatgactga

Sequence Length

1137

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

18044209

NCBI GeneID

56895

Molecular Weight

24,951 Da

NCBI Official Full Name

Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta), mRNA

NCBI Official Synonym Full Names

1-acylglycerol-3-phosphate O-acyltransferase 4

NCBI Official Symbol

AGPAT4

NCBI Official Synonym Symbols

1-AGPAT4; dJ473J16.2; LPAAT-delta

NCBI Protein Information

1-acyl-sn-glycerol-3-phosphate acyltransferase delta

UniProt Protein Name

1-acyl-sn-glycerol-3-phosphate acyltransferase delta

Protein Family

1-acyl-sn-glycerol-3-phosphate acyltransferase

UniProt Gene Name

AGPAT4

UniProt Synonym Gene Names

1-AGP acyltransferase 4; 1-AGPAT 4; LPAAT-delta

UniProt Entry Name

PLCD_HUMAN

NCBI Description

This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. This integral membrane protein converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. [provided by RefSeq, Jul 2008]

Uniprot Description

AGPAT4: Converts lysophosphatidic acid (LPA) into phosphatidic acid by incorporating an acyl moiety at the sn-2 position of the glycerol backbone. Belongs to the 1-acyl-sn-glycerol-3-phosphate acyltransferase family.

Protein type: Lipid Metabolism - glycerophospholipid; Lipid Metabolism - glycerolipid; Membrane protein, integral; EC 2.3.1.51; Membrane protein, multi-pass; Transferase; Lipid Metabolism - ether lipid

Chromosomal Location of Human Ortholog: 6q26

Cellular Component: endoplasmic reticulum membrane

Molecular Function: 1-acylglycerol-3-phosphate O-acyltransferase activity; protein binding

Biological Process: phosphatidic acid biosynthetic process; triacylglycerol biosynthetic process

Research Articles on AGPAT4

1. Clinical trial of gene-disease association and gene-environment interaction. (HuGE Navigator)

Similar Products

Product Notes

The AGPAT4 agpat4 (Catalog #AAA1278185) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacctcg cgggactgct gaagtctcag ttcctgtgcc acctggtctt ctgctacgtc tttattgcct cagggctaat catcaacacc attcagctct tcactctcct cctctggccc attaacaagc agctcttccg gaagatcaac tgcagactgt cctattgcat ctcaagccag ctggtgatgc tgctggagtg gtggtcgggc acggaatgca ccatcttcac ggacccgcgc gcctacctca agtatgggaa ggaaaatgcc atcgtggttc tcaaccacaa gtttgaaatt gactttctgt gtggctggag cctgtccgaa cgctttgggc tgttaggggg ctccaaggtc ctggccaaga aagagctggc ctatgtccca attatcggct ggatgtggta cttcaccgag atggtcttct gttcgcgcaa gtgggagcag gatcgcaaga cggttgccac cagtttgcag cacctccggg actaccccga gaagtatttt ttcctgattc actgtgaggg cacacggttc acggagaaga agcatgagat cagcatgcag gtggcccggg ccaaggggct gcctcgcctc aagcatcacc tgttgccacg aaccaagggc ttcgccatca ccgtgaggag cttgagaaat gtagtttcag ctgtatatga ctgtacactc aatttcagaa ataatgaaaa tccaacactg ctgggagtcc taaacggaaa gaaataccat gcagatttgt atgttaggag gatcccactg gaagacatcc ctgaagacga tgacgagtgc tcggcctggc tgcacaagct ctaccaggag aaggatgcct ttcaggagga gtactacagg acgggcacct tcccagagac gcccatggtg cccccccggc ggccctggac cctcgtgaac tggctgtttt gggcctcgct ggtgctctac cctttcttcc agttcctggt cagcatgatc aggagcgggt cttccctgac gctggccagc ttcatcctcg tcttctttgt ggcctctgtg ggagttcgat ggatgattgg tgtgacggaa attgacaagg gctctgccta cggcaactct gacagcaagc agaaactgaa tgactga. It is sometimes possible for the material contained within the vial of "AGPAT4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

AGPAT4 cdna clone