Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AGBL2 cdna clone

AGBL2 cDNA Clone

Gene Names
AGBL2; CCP2
Synonyms
AGBL2; AGBL2 cDNA Clone; AGBL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggcggatgggaatcctaaacagctacaccatggagtctacctttggcgggtccaccctgggtaataaaagagacacccactttaccatcgaagatctgaagtccttaggttatcatgtctgtgacacccttctggacttttgtgatcctgaccaaattaagttcactcagtgtctagcagagcttaaggagcttctacgacaggaaatccacaagaaattccatgaacttggacaagatgtagatttagaaggaagttggagtgacatctctttgtctgacattgaatccagcaccagtggctctgacagttctctctcagatggtcttcctgttcacctagcaaacatagcagatgagctgactcagaaaaagaagatgtttaagaagaaaaaaaagaagtcacttcagactaggaaacagcgaaatgagcagtatcagaaaaaaaatttgatgcagaagttaaagttaacagaagatacctcagaaaaggcaggatttgcttctactctgcaaaagcagccaacctttttcaaaaactcagagaattccagttttttaccaatgaaaaatgaaaacccaaggttaaatgagacaaatttaaatagaagagacaaagacacccccctggacccatcaatggccaccctgattctgcctaagaataaagggagaatgcagaataagaagccaggctttacagtatcatgctctccaaagagaaccataaactccagccaagagccagctccaggtatgaagccaaactggcctaggagcagatatcctgccacaaagagaggctgtgctgccatggcggcatacccatccttgcacatatacacatacccgtag
Sequence Length
858
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GeneID
Molecular Weight
32,454 Da
NCBI Official Synonym Full Names
ATP/GTP binding protein like 2
NCBI Official Symbol
AGBL2
NCBI Official Synonym Symbols
CCP2
NCBI Protein Information
cytosolic carboxypeptidase 2
UniProt Protein Name
Cytosolic carboxypeptidase 2
UniProt Gene Name
AGBL2
UniProt Synonym Gene Names
CCP2
UniProt Entry Name
CBPC2_HUMAN

Uniprot Description

AGBL2: Metallocarboxypeptidase that may play a role in the processing of tubulin. Belongs to the peptidase M14 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; EC 3.4.17.-

Chromosomal Location of Human Ortholog: 11p11.2

Cellular Component: centriole; cytosol

Molecular Function: metallocarboxypeptidase activity

Research Articles on AGBL2

Similar Products

Product Notes

The AGBL2 agbl2 (Catalog #AAA1269896) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggcgga tgggaatcct aaacagctac accatggagt ctacctttgg cgggtccacc ctgggtaata aaagagacac ccactttacc atcgaagatc tgaagtcctt aggttatcat gtctgtgaca cccttctgga cttttgtgat cctgaccaaa ttaagttcac tcagtgtcta gcagagctta aggagcttct acgacaggaa atccacaaga aattccatga acttggacaa gatgtagatt tagaaggaag ttggagtgac atctctttgt ctgacattga atccagcacc agtggctctg acagttctct ctcagatggt cttcctgttc acctagcaaa catagcagat gagctgactc agaaaaagaa gatgtttaag aagaaaaaaa agaagtcact tcagactagg aaacagcgaa atgagcagta tcagaaaaaa aatttgatgc agaagttaaa gttaacagaa gatacctcag aaaaggcagg atttgcttct actctgcaaa agcagccaac ctttttcaaa aactcagaga attccagttt tttaccaatg aaaaatgaaa acccaaggtt aaatgagaca aatttaaata gaagagacaa agacaccccc ctggacccat caatggccac cctgattctg cctaagaata aagggagaat gcagaataag aagccaggct ttacagtatc atgctctcca aagagaacca taaactccag ccaagagcca gctccaggta tgaagccaaa ctggcctagg agcagatatc ctgccacaaa gagaggctgt gctgccatgg cggcataccc atccttgcac atatacacat acccgtag. It is sometimes possible for the material contained within the vial of "AGBL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.