Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADPRH cdna clone

ADPRH cDNA Clone

Gene Names
ADPRH; ARH1
Synonyms
ADPRH; ADPRH cDNA Clone; ADPRH cdna clone
Ordering
For Research Use Only!
Sequence
atggagaagtatgtggctgctatggtgctgagtgcagctggagatgccctggggtactacaatgggaagtgggagttcctccaggatggggagaagatacaccggcagttggcccagctgggcggcttggatgccctagacgtgggaaggtggagagttagtgacgacacagtgatgcacttggccacagcagaagctcttgtggaagctgggaaagcccctaagttgactcaactgtattacctccttgctaagcattaccaagactgcatggaagacatggatgggcgggcaccaggtggtgcctcggtgcacaacgccatgcagctgaagccgggcaagcccaatggctggaggattcccttcaacagccatgagggcggctgtggggctgccatgcgggccatgtgcatcggtctcaggttcccacaccatagccaactggacacactgatccaagtgagcatcgagagtggtcggatgacccaccaccacccaacaggctacctgggggcccttgcgtctgctctttttacagcctatgcagtgaatagcagaccacccttgcagtggggaaaaggactgatggagctgctaccagaagctaaaaagtacattgtccaatcaggctactttgtagaggaaaatcttcaacactggtcctacttccaaaccaaatgggaaaattacctaaaacttagagggattttggatggagaatcagcccctaccttccctgagtctttcggtgtgaaggagagggatcagttctacacctccctgagctactctggctggggtggcagcagtgggcacgatgcccccatgattgcctacgatgctgttcttgctgcaggagactcctggaaggagcttgcccaccgagcctttttccatggtggagacagtgattctacagctgccattgctggctgctggtggggagttatgtatggttttaaaggagtgagtccctccaactatgagaaactagaatacagaaaccggctggaagagacagctagggctttatattctctcgggtcaaaagaagacactgtaatttccctttag
Sequence Length
1074
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
141
Molecular Weight
39,507 Da
NCBI Official Full Name
Homo sapiens ADP-ribosylarginine hydrolase, mRNA
NCBI Official Synonym Full Names
ADP-ribosylarginine hydrolase
NCBI Official Symbol
ADPRH
NCBI Official Synonym Symbols
ARH1
NCBI Protein Information
ADP-ribosylarginine hydrolase
UniProt Protein Name
[Protein ADP-ribosylarginine] hydrolase
UniProt Gene Name
ADPRH
UniProt Synonym Gene Names
ARH1; ADP-ribosylarginine hydrolase
UniProt Entry Name
ADPRH_HUMAN

NCBI Description

The enzyme encoded by this gene catalyzes removal of mono-ADP-ribose from arginine residues of proteins in the ADP-ribosylation cycle. Unlike the rat and mouse enzymes that require DTT for maximal activity, the human enzyme is DTT-independent. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, May 2014]

Uniprot Description

ADPRH: Catalyzes the reverse reaction of mono-ADP-ribosylation. Belongs to the ADP-ribosylglycohydrolase family.

Protein type: Hydrolase; EC 3.2.2.19

Chromosomal Location of Human Ortholog: 3q13.31-q13.33

Cellular Component: endomembrane system; intracellular

Molecular Function: ADP-ribosylarginine hydrolase activity; GTPase activator activity; protein binding; Rab GTPase binding

Biological Process: intracellular protein transport; protein modification process; regulation of vesicle fusion

Research Articles on ADPRH

Similar Products

Product Notes

The ADPRH adprh (Catalog #AAA1278397) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaagt atgtggctgc tatggtgctg agtgcagctg gagatgccct ggggtactac aatgggaagt gggagttcct ccaggatggg gagaagatac accggcagtt ggcccagctg ggcggcttgg atgccctaga cgtgggaagg tggagagtta gtgacgacac agtgatgcac ttggccacag cagaagctct tgtggaagct gggaaagccc ctaagttgac tcaactgtat tacctccttg ctaagcatta ccaagactgc atggaagaca tggatgggcg ggcaccaggt ggtgcctcgg tgcacaacgc catgcagctg aagccgggca agcccaatgg ctggaggatt cccttcaaca gccatgaggg cggctgtggg gctgccatgc gggccatgtg catcggtctc aggttcccac accatagcca actggacaca ctgatccaag tgagcatcga gagtggtcgg atgacccacc accacccaac aggctacctg ggggcccttg cgtctgctct ttttacagcc tatgcagtga atagcagacc acccttgcag tggggaaaag gactgatgga gctgctacca gaagctaaaa agtacattgt ccaatcaggc tactttgtag aggaaaatct tcaacactgg tcctacttcc aaaccaaatg ggaaaattac ctaaaactta gagggatttt ggatggagaa tcagccccta ccttccctga gtctttcggt gtgaaggaga gggatcagtt ctacacctcc ctgagctact ctggctgggg tggcagcagt gggcacgatg cccccatgat tgcctacgat gctgttcttg ctgcaggaga ctcctggaag gagcttgccc accgagcctt tttccatggt ggagacagtg attctacagc tgccattgct ggctgctggt ggggagttat gtatggtttt aaaggagtga gtccctccaa ctatgagaaa ctagaataca gaaaccggct ggaagagaca gctagggctt tatattctct cgggtcaaaa gaagacactg taatttccct ttag. It is sometimes possible for the material contained within the vial of "ADPRH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.