Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADORA2B cdna clone

ADORA2B cDNA Clone

Gene Names
ADORA2B; ADORA2
Synonyms
ADORA2B; ADORA2B cDNA Clone; ADORA2B cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctggagacacaggacgcgctgtacgtggcgctggagctggtcatcgccgcgctttcggtggcgggcaacgtgctggtgtgcgccgcggtgggcacggcgaacactctgcagacgcccaccaactacttcctggtgtccctggctgcggccgacgtggccgtggggctcttcgccatcccctttgccatcaccatcagcctgggcttctgcactgacttctacggctgcctcttcctcgcctgcttcgtgctggtgctcacgcagagctccatcttcagccttctggccgtggcagtcgacagatacctggccatctgtgtcccgctcaggtataaaagtttggtcacggggacccgagcaagaggggtcattgctgtcctctgggtccttgcctttggcatcggattgactccattcctggggtggaacagtaaagacagtgccaccaacaactgcacagaaccctgggatggaaccacgaatgaaagctgctgccttgtgaagtgtctctttgagaatgtggtccccatgagctacatggtatatttcaatttctttgggtgtgttctgcccccactgcttataatgctggtgatctacattaagatcttcctggtggcctgcaggcagcttcagcgcactgagctgatggaccactcgaggaccaccctccagcgggagatccatgcagccaagtcactggccatgattgtggggatttttgccctgtgctggttacctgtgcatgctgttaactgtgtcactcttttccagccagctcagggtaaaaataagcccaagtgggcaatgaatatggccattcttctgtcacatgccaattcagttgtcaatcccattgtctatgcttaccggaaccgagacttccgctacacttttcacaaaattatctccaggtatcttctctgccaagcagatgtcaagagtgggaatggtcaggctggggtacagcctgctctcggtgtgggcctatga
Sequence Length
999
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
136
Molecular Weight
36,333 Da
NCBI Official Full Name
Homo sapiens adenosine A2b receptor, mRNA
NCBI Official Synonym Full Names
adenosine A2b receptor
NCBI Official Symbol
ADORA2B
NCBI Official Synonym Symbols
ADORA2
NCBI Protein Information
adenosine receptor A2b
UniProt Protein Name
Adenosine receptor A2b
Protein Family
UniProt Gene Name
ADORA2B
UniProt Entry Name
AA2BR_HUMAN

NCBI Description

This gene encodes an adenosine receptor that is a member of the G protein-coupled receptor superfamily. This integral membrane protein stimulates adenylate cyclase activity in the presence of adenosine. This protein also interacts with netrin-1, which is involved in axon elongation. The gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]

Uniprot Description

ADORA2B: Receptor for adenosine. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Membrane protein, multi-pass; Membrane protein, integral; Receptor, GPCR

Chromosomal Location of Human Ortholog: 17p12

Cellular Component: integral to plasma membrane; plasma membrane

Biological Process: activation of MAPK activity; adenylate cyclase activation; cellular defense response; cellular protein metabolic process; excretion; G-protein coupled receptor protein signaling pathway; JNK cascade

Research Articles on ADORA2B

Similar Products

Product Notes

The ADORA2B adora2b (Catalog #AAA1277647) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgg agacacagga cgcgctgtac gtggcgctgg agctggtcat cgccgcgctt tcggtggcgg gcaacgtgct ggtgtgcgcc gcggtgggca cggcgaacac tctgcagacg cccaccaact acttcctggt gtccctggct gcggccgacg tggccgtggg gctcttcgcc atcccctttg ccatcaccat cagcctgggc ttctgcactg acttctacgg ctgcctcttc ctcgcctgct tcgtgctggt gctcacgcag agctccatct tcagccttct ggccgtggca gtcgacagat acctggccat ctgtgtcccg ctcaggtata aaagtttggt cacggggacc cgagcaagag gggtcattgc tgtcctctgg gtccttgcct ttggcatcgg attgactcca ttcctggggt ggaacagtaa agacagtgcc accaacaact gcacagaacc ctgggatgga accacgaatg aaagctgctg ccttgtgaag tgtctctttg agaatgtggt ccccatgagc tacatggtat atttcaattt ctttgggtgt gttctgcccc cactgcttat aatgctggtg atctacatta agatcttcct ggtggcctgc aggcagcttc agcgcactga gctgatggac cactcgagga ccaccctcca gcgggagatc catgcagcca agtcactggc catgattgtg gggatttttg ccctgtgctg gttacctgtg catgctgtta actgtgtcac tcttttccag ccagctcagg gtaaaaataa gcccaagtgg gcaatgaata tggccattct tctgtcacat gccaattcag ttgtcaatcc cattgtctat gcttaccgga accgagactt ccgctacact tttcacaaaa ttatctccag gtatcttctc tgccaagcag atgtcaagag tgggaatggt caggctgggg tacagcctgc tctcggtgtg ggcctatga. It is sometimes possible for the material contained within the vial of "ADORA2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.