Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADIPOR1 cdna clone

ADIPOR1 cDNA Clone

Gene Names
ADIPOR1; CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A
Synonyms
ADIPOR1; ADIPOR1 cDNA Clone; ADIPOR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcttcccacaaaggatctgtggtggcacaggggaatggggctcctgccagtaacagggaagctgacacggtggaactggctgaactgggacccctgctagaagagaagggcaaacgggtaatcgccaacccacccaaagctgaagaagagcaaacatgcccagtgccccaggaagaagaggaggaggtgcgggtactgacacttcccctgcaagcccaccacgccatggagaagatggaagagtttgtgtacaaggtctgggagggacgttggagggtcatcccatatgatgtgctccctgactggctaaaggacaacgactatctgctacatggtcatagacctcccatgccctcctttcgggcttgcttcaagagcatcttccgcattcatacagaaactggcaacatctggacccatctgcttggtttcgtgctgtttctctttttgggaatcttgaccatgctcagaccaaatatgtacttcatggcccctctacaggagaaggtggtttttgggatgttctttttgggtgcagtgctctgcctcagcttctcctggctctttcacaccgtctattgtcattcagagaaagtctctcggactttttccaaactggactattcagggattgctcttctaattatggggagctttgtcccctggctctattattccttctactgctccccacagccacggctcatctacctctccatcgtctgtgtcctgggcatttctgccatcattgtggcgcagtgggaccggtttgccactcctaagcaccggcagacaagagcaggcgtgttcctgggacttggcttgagtggcgtcgtgcccaccatgcactttactatcgctgagggctttgtcaaggccaccacagtgggccagatgggctggttcttcctcatggctgtgatgtacatcactggagctggcctttatgctgctcgaattcctgagcgcttctttcctggaaaatttgacatatggttccagtctcatcagattttccatgtcctggtggtggcagcagcctttgtccacttctatggagtctccaaccttcaggaattccgttacggcctagaaggcggctgtactgatgacacccttctctga
Sequence Length
1128
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,616 Da
NCBI Official Full Name
Homo sapiens adiponectin receptor 1, mRNA
NCBI Official Synonym Full Names
adiponectin receptor 1
NCBI Official Symbol
ADIPOR1
NCBI Official Synonym Symbols
CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A
NCBI Protein Information
adiponectin receptor protein 1
UniProt Protein Name
Adiponectin receptor protein 1
UniProt Gene Name
ADIPOR1
UniProt Entry Name
ADR1_HUMAN

NCBI Description

This gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. Binding of adiponectin to the encoded protein results in activation of an AMP-activated kinase signaling pathway which affects levels of fatty acid oxidation and insulin sensitivity. A pseudogene of this gene is located on chromosome 14. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2014]

Uniprot Description

ADIPOR1: Receptor for globular and full-length adiponectin (APM1), an essential hormone secreted by adipocytes that acts as an antidiabetic. Probably involved in metabolic pathways that regulate lipid metabolism such as fatty acid oxidation. Mediates increased AMPK, PPARA ligand activity, fatty acid oxidation and glucose uptake by adiponectin. Has some high-affinity receptor for globular adiponectin but low-affinity receptor for full-length adiponectin. Belongs to the ADIPOR family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q32.1

Cellular Component: intrinsic to plasma membrane; membrane; plasma membrane

Molecular Function: adiponectin binding; protein kinase binding

Biological Process: adiponectin-mediated signaling pathway; fatty acid oxidation; glucose homeostasis; hormone-mediated signaling; negative regulation of JAK-STAT cascade; regulation of lipid metabolic process

Research Articles on ADIPOR1

Similar Products

Product Notes

The ADIPOR1 adipor1 (Catalog #AAA1273039) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcttccc acaaaggatc tgtggtggca caggggaatg gggctcctgc cagtaacagg gaagctgaca cggtggaact ggctgaactg ggacccctgc tagaagagaa gggcaaacgg gtaatcgcca acccacccaa agctgaagaa gagcaaacat gcccagtgcc ccaggaagaa gaggaggagg tgcgggtact gacacttccc ctgcaagccc accacgccat ggagaagatg gaagagtttg tgtacaaggt ctgggaggga cgttggaggg tcatcccata tgatgtgctc cctgactggc taaaggacaa cgactatctg ctacatggtc atagacctcc catgccctcc tttcgggctt gcttcaagag catcttccgc attcatacag aaactggcaa catctggacc catctgcttg gtttcgtgct gtttctcttt ttgggaatct tgaccatgct cagaccaaat atgtacttca tggcccctct acaggagaag gtggtttttg ggatgttctt tttgggtgca gtgctctgcc tcagcttctc ctggctcttt cacaccgtct attgtcattc agagaaagtc tctcggactt tttccaaact ggactattca gggattgctc ttctaattat ggggagcttt gtcccctggc tctattattc cttctactgc tccccacagc cacggctcat ctacctctcc atcgtctgtg tcctgggcat ttctgccatc attgtggcgc agtgggaccg gtttgccact cctaagcacc ggcagacaag agcaggcgtg ttcctgggac ttggcttgag tggcgtcgtg cccaccatgc actttactat cgctgagggc tttgtcaagg ccaccacagt gggccagatg ggctggttct tcctcatggc tgtgatgtac atcactggag ctggccttta tgctgctcga attcctgagc gcttctttcc tggaaaattt gacatatggt tccagtctca tcagattttc catgtcctgg tggtggcagc agcctttgtc cacttctatg gagtctccaa ccttcaggaa ttccgttacg gcctagaagg cggctgtact gatgacaccc ttctctga. It is sometimes possible for the material contained within the vial of "ADIPOR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.