Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADH4 cdna clone

ADH4 cDNA Clone

Gene Names
ADH4; ADH-2; HEL-S-4
Synonyms
ADH4; ADH4 cDNA Clone; ADH4 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcaccaagggcaaagttattaaatgcaaagcagccatcgcctgggaagcaggcaagcccctttgcattgaagaggttgaagtagctccccccaaggctcatgaagttcgcattcagatcattgctacctccctgtgccatactgatgccactgttatcgattctaaatttgagggcctagctttcccagtgatcgttggccatgaggctgcaggtattgtggaaagtattgggccaggagtgaccaacgtcaaaccaggtgacaaagtaattccactttatgcacctctatgtagaaaatgcaagttttgtctgagtccactcacaaatttgtgtgggaaaatcagtaatctcaaaagtcctgctagtgatcaacaactaatggaagacaaaaccagcaggtttacctgcaaaggaaaaccagtttaccatttctttggaaccagtacattctctcagtacactgtggtgtcagatatcaatcttgccaaaatagatgatgatgcaaatttagagagagtttgtctgcttggatgtgggttttcaactggctatggggctgcaatcaacaatgccaaggtcacccctggttcgacttgtgctgtctttggcctaggaggtgtgggtctttctgctgtaatgggttgtaaagcagcaggagcttccagaatcataggtattgacatcaacagtgagaagtttgtgaaggctaaagccctgggagccactgactgcctcaatcctagagacttacataaacctatccaggaagttatcattgaattgaccaagggaggtgtggattttgcccttgactgtgcaggtggatctgaaaccatgaaagcagccctggactgtacaaccgcaggctggggatcatgtactttcattggagtagctgctggtagcaaaggattgactgtttttccagaggagctaataatcggccgtactataaatggaacattctttggtggttggaaaagtgtagattctatcccaaagctggtcactgactataagaataagaaattcaatctggatgcactggtgacccataccctgccttttgacaaaatcagtgaggcatttgacctaatgaaccaaggaaaaagcatccgaacaatcctcatcttttga
Sequence Length
1143
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
127
Molecular Weight
42,607 Da
NCBI Official Full Name
Homo sapiens alcohol dehydrogenase 4 (class II), pi polypeptide, mRNA
NCBI Official Synonym Full Names
alcohol dehydrogenase 4 (class II), pi polypeptide
NCBI Official Symbol
ADH4
NCBI Official Synonym Symbols
ADH-2; HEL-S-4
NCBI Protein Information
alcohol dehydrogenase 4
UniProt Protein Name
Alcohol dehydrogenase 4
Protein Family
UniProt Gene Name
ADH4
UniProt Entry Name
ADH4_HUMAN

NCBI Description

This gene encodes class II alcohol dehydrogenase 4 pi subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class II alcohol dehydrogenase is a homodimer composed of 2 pi subunits. It exhibits a high activity for oxidation of long-chain aliphatic alcohols and aromatic alcohols and is less sensitive to pyrazole. This gene is localized to chromosome 4 in the cluster of alcohol dehydrogenase genes. [provided by RefSeq, Jul 2008]

Uniprot Description

ADH4: class II alcohol dehydrogenase 4 pi subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class II alcohol dehydrogenase is a homodimer composed of 2 pi subunits. It exhibits a high activity for oxidation of long-chain aliphatic alcohols and aromatic alcohols and is less sensitive to pyrazole. This gene is localized to chromosome 4 in the cluster of alcohol dehydrogenase genes. [provided by RefSeq, Jul 2008]

Protein type: Xenobiotic Metabolism - drug metabolism - cytochrome P450; Cofactor and Vitamin Metabolism - retinol; EC 1.1.1.1; Amino Acid Metabolism - tyrosine; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Xenobiotic Metabolism - metabolism by cytochrome P450; Oxidoreductase; Lipid Metabolism - fatty acid

Chromosomal Location of Human Ortholog: 4q22

Cellular Component: cytosol

Molecular Function: alcohol dehydrogenase activity; alcohol dehydrogenase activity, zinc-dependent; all-trans retinal binding; benzaldehyde dehydrogenase activity; NAD binding; NADPH:quinone reductase activity; oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor; retinol binding; retinol dehydrogenase activity; zinc ion binding

Biological Process: alcohol catabolic process; alcohol metabolic process; aldehyde metabolic process; ethanol oxidation; retinoid metabolic process; retinol metabolic process

Research Articles on ADH4

Similar Products

Product Notes

The ADH4 adh4 (Catalog #AAA1271613) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcacca agggcaaagt tattaaatgc aaagcagcca tcgcctggga agcaggcaag cccctttgca ttgaagaggt tgaagtagct ccccccaagg ctcatgaagt tcgcattcag atcattgcta cctccctgtg ccatactgat gccactgtta tcgattctaa atttgagggc ctagctttcc cagtgatcgt tggccatgag gctgcaggta ttgtggaaag tattgggcca ggagtgacca acgtcaaacc aggtgacaaa gtaattccac tttatgcacc tctatgtaga aaatgcaagt tttgtctgag tccactcaca aatttgtgtg ggaaaatcag taatctcaaa agtcctgcta gtgatcaaca actaatggaa gacaaaacca gcaggtttac ctgcaaagga aaaccagttt accatttctt tggaaccagt acattctctc agtacactgt ggtgtcagat atcaatcttg ccaaaataga tgatgatgca aatttagaga gagtttgtct gcttggatgt gggttttcaa ctggctatgg ggctgcaatc aacaatgcca aggtcacccc tggttcgact tgtgctgtct ttggcctagg aggtgtgggt ctttctgctg taatgggttg taaagcagca ggagcttcca gaatcatagg tattgacatc aacagtgaga agtttgtgaa ggctaaagcc ctgggagcca ctgactgcct caatcctaga gacttacata aacctatcca ggaagttatc attgaattga ccaagggagg tgtggatttt gcccttgact gtgcaggtgg atctgaaacc atgaaagcag ccctggactg tacaaccgca ggctggggat catgtacttt cattggagta gctgctggta gcaaaggatt gactgttttt ccagaggagc taataatcgg ccgtactata aatggaacat tctttggtgg ttggaaaagt gtagattcta tcccaaagct ggtcactgac tataagaata agaaattcaa tctggatgca ctggtgaccc ataccctgcc ttttgacaaa atcagtgagg catttgacct aatgaaccaa ggaaaaagca tccgaacaat cctcatcttt tga. It is sometimes possible for the material contained within the vial of "ADH4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.