Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADH1A cdna clone

ADH1A cDNA Clone

Gene Names
ADH1A; ADH1
Synonyms
ADH1A; ADH1A cDNA Clone; ADH1A cdna clone
Ordering
For Research Use Only!
Sequence
atgagcacagcaggaaaagtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagttcgtattaagatggtggctgtaggaatctgtggcacagatgaccacgtggttagtggtaccatggtgaccccacttcctgtgattttaggccatgaggcagccggcatcgtggagagtgttggagaaggggtgactacagtcaaaccaggtgataaagtcatcccactcgctattcctcagtgtggaaaatgcagaatttgtaaaaacccggagagcaactactgcttgaaaaacgatgtaagcaatcctcaggggaccctgcaggatggcaccagcaggttcacctgcaggaggaagcccatccaccacttccttggcatcagcaccttctcacagtacacagtggtggatgaaaatgcagtagccaaaattgatgcagcctcgcctctagagaaagtctgtctcattggctgtggattttcaactggttatgggtctgcagtcaatgttgccaaggtcaccccaggctctacctgtgctgtgtttggcctgggaggggtcggcctatctgctattatgggctgtaaagcagctggggcagccagaatcattgcggtggacatcaacaaggacaaatttgcaaaggccaaagagttgggtgccactgaatgcatcaaccctcaagactacaagaaacccatccaggaggtgctaaaggaaatgactgatggaggtgtggatttttcatttgaagtcatcggtcggcttgacaccatgatggcttccctgttatgttgtcatgaggcatgtggcacaagtgtcatcgtaggggtacctcctgattcccaaaacctctcaatgaaccctatgctgctactgactggacgtacctggaagggagctattcttggtggctttaaaagtaaagaatgtgtcccaaaacttgtggctgattttatggctaagaagttttcattggatgcattaataacccatgttttaccttttgaaaaaataaatgaaggatttgacctgcttcactctgggaaaagtatccgtaccattctgatgttttga
Sequence Length
1128
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
124
Molecular Weight
39,859 Da
NCBI Official Full Name
Homo sapiens alcohol dehydrogenase 1A (class I), alpha polypeptide, mRNA
NCBI Official Synonym Full Names
alcohol dehydrogenase 1A (class I), alpha polypeptide
NCBI Official Symbol
ADH1A
NCBI Official Synonym Symbols
ADH1
NCBI Protein Information
alcohol dehydrogenase 1A
UniProt Protein Name
Alcohol dehydrogenase 1A
UniProt Gene Name
ADH1A
UniProt Synonym Gene Names
ADH1
UniProt Entry Name
ADH1A_HUMAN

NCBI Description

This gene encodes a member of the alcohol dehydrogenase family. The encoded protein is the alpha subunit of class I alcohol dehydrogenase, which consists of several homo- and heterodimers of alpha, beta and gamma subunits. Alcohol dehydrogenases catalyze the oxidation of alcohols to aldehydes. This gene is active in the liver in early fetal life but only weakly active in adult liver. This gene is found in a cluster with six additional alcohol dehydrogenase genes, including those encoding the beta and gamma subunits, on the long arm of chromosome 4. Mutations in this gene may contribute to variation in certain personality traits and substance dependence. [provided by RefSeq, Nov 2010]

Uniprot Description

ADH1A: a member of the alcohol dehydrogenase family. The encoded protein is the alpha subunit of class I alcohol dehydrogenase, which consists of several homo- and heterodimers of alpha, beta and gamma subunits. Alcohol dehydrogenases catalyze the oxidation of alcohols to aldehydes. This gene is active in the liver in early fetal life but only weakly active in adult liver. This gene is found in a cluster with six additional alcohol dehydrogenase genes, including those encoding the beta and gamma subunits, on the long arm of chromosome 4. Mutations in this gene may contribute to variation in certain personality traits and substance dependence. [provided by RefSeq, Nov 2010]

Protein type: Xenobiotic Metabolism - drug metabolism - cytochrome P450; Cofactor and Vitamin Metabolism - retinol; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Oxidoreductase; Xenobiotic Metabolism - metabolism by cytochrome P450; Amino Acid Metabolism - tyrosine; Transcription regulation; Lipid Metabolism - fatty acid; EC 1.1.1.1

Chromosomal Location of Human Ortholog: 4q23

Cellular Component: cytosol

Molecular Function: alcohol dehydrogenase activity; alcohol dehydrogenase activity, zinc-dependent; protein binding; retinol dehydrogenase activity

Biological Process: drug metabolic process; ethanol oxidation

Research Articles on ADH1A

Similar Products

Product Notes

The ADH1A adh1a (Catalog #AAA1277954) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcacag caggaaaagt aatcaaatgc aaagcagctg tgctatggga gttaaagaaa cccttttcca ttgaggaggt ggaggttgca cctcctaagg cccatgaagt tcgtattaag atggtggctg taggaatctg tggcacagat gaccacgtgg ttagtggtac catggtgacc ccacttcctg tgattttagg ccatgaggca gccggcatcg tggagagtgt tggagaaggg gtgactacag tcaaaccagg tgataaagtc atcccactcg ctattcctca gtgtggaaaa tgcagaattt gtaaaaaccc ggagagcaac tactgcttga aaaacgatgt aagcaatcct caggggaccc tgcaggatgg caccagcagg ttcacctgca ggaggaagcc catccaccac ttccttggca tcagcacctt ctcacagtac acagtggtgg atgaaaatgc agtagccaaa attgatgcag cctcgcctct agagaaagtc tgtctcattg gctgtggatt ttcaactggt tatgggtctg cagtcaatgt tgccaaggtc accccaggct ctacctgtgc tgtgtttggc ctgggagggg tcggcctatc tgctattatg ggctgtaaag cagctggggc agccagaatc attgcggtgg acatcaacaa ggacaaattt gcaaaggcca aagagttggg tgccactgaa tgcatcaacc ctcaagacta caagaaaccc atccaggagg tgctaaagga aatgactgat ggaggtgtgg atttttcatt tgaagtcatc ggtcggcttg acaccatgat ggcttccctg ttatgttgtc atgaggcatg tggcacaagt gtcatcgtag gggtacctcc tgattcccaa aacctctcaa tgaaccctat gctgctactg actggacgta cctggaaggg agctattctt ggtggcttta aaagtaaaga atgtgtccca aaacttgtgg ctgattttat ggctaagaag ttttcattgg atgcattaat aacccatgtt ttaccttttg aaaaaataaa tgaaggattt gacctgcttc actctgggaa aagtatccgt accattctga tgttttga. It is sometimes possible for the material contained within the vial of "ADH1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.