Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADD3 cdna clone

ADD3 cDNA Clone

Gene Names
ADD3; ADDL; CPSQ3
Synonyms
ADD3; ADD3 cDNA Clone; ADD3 cdna clone
Ordering
For Research Use Only!
Sequence
atgagctcagatgccagccaaggcgtgattaccactcctcctcctcccagcatgcctcacaaagagagatattttgaccgcatcaatgaaaatgacccagaatacattagggagaggaacatgtctcctgatctacgacaagacttcaacatgatggagcagaggaaacgagttactcagatcctgcaaagtcctgcctttcgggaagacttggaatgccttattcaagaacagatgaagaaaggccacaacccaactggattactagcattacagcagattgcagattacatcatggccaattctttctcgggtttttcttcacctcctctcagtcttggcatggtcacacctatcaatgaccttcctggtgcagatacatcctcatatgtgaagggagaaaaacttactcgctgtaaacttgccagcctgtacagacttgtagacttgtttggatgggcacacctggcaaatacctatatctcagtaagaataagtaaggagcaagaccacattataataattcccagaggcctatctttttctgaagctacagcctccaatttggtgaaagtcaatataataggagaagtggttgaccagggaagtaccaatttgaaaattgaccatacaggattcagtccccatgctgcaatctattcaacacgtcctgatgttaagtgtgtgatacacatccatacccttgcaacagcagctgtatcctccatgaaatgtgggatccttccaatttctcaagagtctcttcttctgggagatgttgcctattatgactaccaagggtcacttgaagaacaggaggagagaattcaactgcagaaggttctgggaccaagttgtaaggtgctggtactcaggaatcatggtgtggttgcacttggagaaacattagaggaggcttttcattatatttttaatgtgcaactagcctgtgagattcaggtgcaggccctagcaggtgcaggtggagtagacaatctccatgtactggactttcagaagtataaagctttcacttacactgtagcagcgtctggtggaggaggtgtgaatatgggttcccatcaaaaatggaaggttggcgaaattgagtttgaagggcttatgaggactctggacaacttggggtatagaacaggctatgcttacaggcatcctctcattcgagagaagcctaggcacaagagtgatgtggaaatcccagcaactgtgactgctttttcctttgaagacgatacagtgccactctctcctctcaaatacatggcacagaggcaacagcgtgaaaaaacaagatggctgaactcaccaaatacttacatgaaagtgaatgtgcctgaggagtctcggaacggagaaaccagtccccgaaccaaaatcacgtggatgaaagcagaagactcatctaaagttagtggtggaacacctatcaaaattgaagatccaaatcagtttgttcctttaaacacaaacccgaatgaggtactagaaaagagaaataagattcgggaacaaaatcgatatgacttgaaaacagcaggaccacaatctcagttgcttgctggaattgttgtggataagccaccttctactatgcaatttgaagatgatgatcatggcccaccagctcctcctaacccatttagtcatctcacagaaggagaacttgaagagtataagaggacaatcgaacgtaaacaacaaggcctagaagatgctgagcaggaattactctcagatgacgcttcatctgtttcacaaattcagtctcaaactcagtcaccgcaaaatgtccctgaaaaattagaagaaaaccatgagctgttttccaagagcttcatctccatggaagtgcctgtcatggtagtaaatggcaaggatgatatgcatgatgttgaagatgagcttgctaagcgagtgagtaggttaagcacaagtacaaccatagaaaacatcgagattactattaagtctccagagaaaatcgaagaagtcctgtcacctgaaggctccccttcaaaatcgccatccaagaaaaagaagaaattccgcactccttcttttctgaaaaagaacaaaaaaaaggagaaagttgaggcctaa
Sequence Length
2121
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
120
Molecular Weight
75,671 Da
NCBI Official Full Name
Homo sapiens adducin 3 (gamma), mRNA
NCBI Official Synonym Full Names
adducin 3
NCBI Official Symbol
ADD3
NCBI Official Synonym Symbols
ADDL; CPSQ3
NCBI Protein Information
gamma-adducin
UniProt Protein Name
Gamma-adducin
Protein Family
UniProt Gene Name
ADD3
UniProt Synonym Gene Names
ADDL
UniProt Entry Name
ADDG_HUMAN

NCBI Description

Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]

Uniprot Description

ADD3: is a heteromeric protein composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. Adducins alpha and gamma are ubiquitously expressed, while the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions of alpha and beta have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described.

Protein type: Cytoskeletal; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 10q25.2

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; plasma membrane

Molecular Function: structural constituent of cytoskeleton

Biological Process: transmembrane transport

Disease: Cerebral Palsy, Spastic Quadriplegic, 3

Research Articles on ADD3

Similar Products

Product Notes

The ADD3 add3 (Catalog #AAA1268774) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctcag atgccagcca aggcgtgatt accactcctc ctcctcccag catgcctcac aaagagagat attttgaccg catcaatgaa aatgacccag aatacattag ggagaggaac atgtctcctg atctacgaca agacttcaac atgatggagc agaggaaacg agttactcag atcctgcaaa gtcctgcctt tcgggaagac ttggaatgcc ttattcaaga acagatgaag aaaggccaca acccaactgg attactagca ttacagcaga ttgcagatta catcatggcc aattctttct cgggtttttc ttcacctcct ctcagtcttg gcatggtcac acctatcaat gaccttcctg gtgcagatac atcctcatat gtgaagggag aaaaacttac tcgctgtaaa cttgccagcc tgtacagact tgtagacttg tttggatggg cacacctggc aaatacctat atctcagtaa gaataagtaa ggagcaagac cacattataa taattcccag aggcctatct ttttctgaag ctacagcctc caatttggtg aaagtcaata taataggaga agtggttgac cagggaagta ccaatttgaa aattgaccat acaggattca gtccccatgc tgcaatctat tcaacacgtc ctgatgttaa gtgtgtgata cacatccata cccttgcaac agcagctgta tcctccatga aatgtgggat ccttccaatt tctcaagagt ctcttcttct gggagatgtt gcctattatg actaccaagg gtcacttgaa gaacaggagg agagaattca actgcagaag gttctgggac caagttgtaa ggtgctggta ctcaggaatc atggtgtggt tgcacttgga gaaacattag aggaggcttt tcattatatt tttaatgtgc aactagcctg tgagattcag gtgcaggccc tagcaggtgc aggtggagta gacaatctcc atgtactgga ctttcagaag tataaagctt tcacttacac tgtagcagcg tctggtggag gaggtgtgaa tatgggttcc catcaaaaat ggaaggttgg cgaaattgag tttgaagggc ttatgaggac tctggacaac ttggggtata gaacaggcta tgcttacagg catcctctca ttcgagagaa gcctaggcac aagagtgatg tggaaatccc agcaactgtg actgcttttt cctttgaaga cgatacagtg ccactctctc ctctcaaata catggcacag aggcaacagc gtgaaaaaac aagatggctg aactcaccaa atacttacat gaaagtgaat gtgcctgagg agtctcggaa cggagaaacc agtccccgaa ccaaaatcac gtggatgaaa gcagaagact catctaaagt tagtggtgga acacctatca aaattgaaga tccaaatcag tttgttcctt taaacacaaa cccgaatgag gtactagaaa agagaaataa gattcgggaa caaaatcgat atgacttgaa aacagcagga ccacaatctc agttgcttgc tggaattgtt gtggataagc caccttctac tatgcaattt gaagatgatg atcatggccc accagctcct cctaacccat ttagtcatct cacagaagga gaacttgaag agtataagag gacaatcgaa cgtaaacaac aaggcctaga agatgctgag caggaattac tctcagatga cgcttcatct gtttcacaaa ttcagtctca aactcagtca ccgcaaaatg tccctgaaaa attagaagaa aaccatgagc tgttttccaa gagcttcatc tccatggaag tgcctgtcat ggtagtaaat ggcaaggatg atatgcatga tgttgaagat gagcttgcta agcgagtgag taggttaagc acaagtacaa ccatagaaaa catcgagatt actattaagt ctccagagaa aatcgaagaa gtcctgtcac ctgaaggctc cccttcaaaa tcgccatcca agaaaaagaa gaaattccgc actccttctt ttctgaaaaa gaacaaaaaa aaggagaaag ttgaggccta a. It is sometimes possible for the material contained within the vial of "ADD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.