Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADC cdna clone

ADC cDNA Clone

Gene Names
AZIN2; ADC; AZI2; ODCp; AZIB1; ODC-p; ODC1L
Synonyms
ADC; ADC cDNA Clone; ADC cdna clone
Ordering
For Research Use Only!
Sequence
atggctggctacctgagtgaatcggactttgtgatggtggaggagggcttcagtacccgagacctgctgaaggaactcactctgggggcctcacaggccaccacggacgaggtagctgccttcttcgtggctgacctgggtgccatagtgaggaagcacttttgctttctgaagtgcctgccacgagtccggcccttttatgctgtcaagtgcaacagcagcccaggtgtgctgaaggttctggcccagctggggctgggctttagctgtgccaacaaggcagagatggagttggtccagcatattggaatccctgccagtaagatcatctgcgccaacccctgtaagcaaattgcacagatcaaatatgctgccaagcatgggatccagctgctgagctttgacaatgagatggagctggcaaaggtggtaaagagccaccccagtgccaagatggttctgtgcattgctaccgatgactcccactccctgagctgcctgagcctaaagtttggagtgtcactgaaatcctgcagacacctgcttgaaaatgcgaagaagcaccatgtggaggtggtgggtgtgagttttcacattggcagtggctgtcctgaccctcaggcctatgctcagtccatcgcagacgcccggctcgtgtttgaaatgggcaccgagctgggtcacaagatgcacgttctggaccttggtggtggcttccctggcacagaaggggccaaagtgagatttgaagagattgcttccgtgatcaactcagccttggacctgtacttcccagagggctgtggcgtggacatctttgctgagctggggcgctactacgtgacctcggccttcactgtggcagtcagcatcattgccaagaaggaggttctgctagaccagcctggcagggaggaggaaaatggttccacctccaagaccatcgtgtaccaccttgatgagggcgtgtatgggatcttcaactcagtcctgtttgacaacatctgccctacccccatcctgcagaagaaaccatccacggagcagcccctgtacagcagcagcctgtggggcccggcggttgatggctgtgattgcgtggctgagggcctgtggctgccgcaactacacgtaggggactggctggtctttgacaacatgggcgcctacactgtgggcatgggttcccccttttgggggacccaggcctgccacatcacctatgccatgtcccgggtggcctgggaagcgctgcgaaggcagctgatggctgcagaacaggaggatgacgtggagggtgtgtgcaagcctctgtcctgcggctgggagatcacagacaccctgtgcgtgggccctgtcttcaccccagcgagcatcatgtga
Sequence Length
1383
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,300 Da
NCBI Official Full Name
Homo sapiens arginine decarboxylase, mRNA
NCBI Official Synonym Full Names
antizyme inhibitor 2
NCBI Official Symbol
AZIN2
NCBI Official Synonym Symbols
ADC; AZI2; ODCp; AZIB1; ODC-p; ODC1L
NCBI Protein Information
antizyme inhibitor 2
UniProt Protein Name
Antizyme inhibitor 2
UniProt Gene Name
AZIN2
UniProt Synonym Gene Names
ADC; KIAA1945; ODCP; AzI2; ADC; ARGDC; ODC-like protein; ODC-p
UniProt Entry Name
AZIN2_HUMAN

NCBI Description

The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. Accumulation of antizyme inhibitor 2 has also been observed in brains of patients with Alzheimer's disease. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]

Uniprot Description

ADC: Decarboxylates L-arginine to agmatine. Truncated splice isoforms probably lack activity. Belongs to the Orn/Lys/Arg decarboxylase class-II family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial; EC 4.1.1.19; Amino Acid Metabolism - arginine and proline; Lyase

Chromosomal Location of Human Ortholog: 1p35.1

Cellular Component: axon; cis-Golgi network; cytoplasmic vesicle; cytosol; dendrite; ER-Golgi intermediate compartment membrane; nucleus; perikaryon; perinuclear region of cytoplasm; trans-Golgi network; transport vesicle

Molecular Function: arginine decarboxylase activity; ornithine decarboxylase activator activity; protein binding; putrescine transmembrane transporter activity

Biological Process: negative regulation of protein catabolic process; positive regulation of catalytic activity; putrescine biosynthetic process from ornithine; putrescine transport

Research Articles on ADC

Similar Products

Product Notes

The ADC azin2 (Catalog #AAA1273448) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggct acctgagtga atcggacttt gtgatggtgg aggagggctt cagtacccga gacctgctga aggaactcac tctgggggcc tcacaggcca ccacggacga ggtagctgcc ttcttcgtgg ctgacctggg tgccatagtg aggaagcact tttgctttct gaagtgcctg ccacgagtcc ggccctttta tgctgtcaag tgcaacagca gcccaggtgt gctgaaggtt ctggcccagc tggggctggg ctttagctgt gccaacaagg cagagatgga gttggtccag catattggaa tccctgccag taagatcatc tgcgccaacc cctgtaagca aattgcacag atcaaatatg ctgccaagca tgggatccag ctgctgagct ttgacaatga gatggagctg gcaaaggtgg taaagagcca ccccagtgcc aagatggttc tgtgcattgc taccgatgac tcccactccc tgagctgcct gagcctaaag tttggagtgt cactgaaatc ctgcagacac ctgcttgaaa atgcgaagaa gcaccatgtg gaggtggtgg gtgtgagttt tcacattggc agtggctgtc ctgaccctca ggcctatgct cagtccatcg cagacgcccg gctcgtgttt gaaatgggca ccgagctggg tcacaagatg cacgttctgg accttggtgg tggcttccct ggcacagaag gggccaaagt gagatttgaa gagattgctt ccgtgatcaa ctcagccttg gacctgtact tcccagaggg ctgtggcgtg gacatctttg ctgagctggg gcgctactac gtgacctcgg ccttcactgt ggcagtcagc atcattgcca agaaggaggt tctgctagac cagcctggca gggaggagga aaatggttcc acctccaaga ccatcgtgta ccaccttgat gagggcgtgt atgggatctt caactcagtc ctgtttgaca acatctgccc tacccccatc ctgcagaaga aaccatccac ggagcagccc ctgtacagca gcagcctgtg gggcccggcg gttgatggct gtgattgcgt ggctgagggc ctgtggctgc cgcaactaca cgtaggggac tggctggtct ttgacaacat gggcgcctac actgtgggca tgggttcccc cttttggggg acccaggcct gccacatcac ctatgccatg tcccgggtgg cctgggaagc gctgcgaagg cagctgatgg ctgcagaaca ggaggatgac gtggagggtg tgtgcaagcc tctgtcctgc ggctgggaga tcacagacac cctgtgcgtg ggccctgtct tcaccccagc gagcatcatg tga. It is sometimes possible for the material contained within the vial of "ADC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.