Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACTB cdna clone

ACTB cDNA Clone

Gene Names
ACTB; BRWS1; PS1TP5BP1
Synonyms
ACTB; ACTB cDNA Clone; ACTB cdna clone
Ordering
For Research Use Only!
Sequence
atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggcccagagcaagagaggcatcctcaccctgaagtaccccatcgagcacggcatcgtcaccaactgggacgacatggagaaaatctggcaccacaccttctacaatgagctgcgtgtggctcccgaggagcaccccgtgctgctgaccgaggcccccctgaaccccaaggccaaccgcgagaagatgacccagatcatgtttgagaccttcaacaccccagccatgtacgttgctatccaggctgtgctatccctgtacgcctctggccgtaccactggcatcgtgatggactccggtgacggggtcacccacactgtgcccatctacgaggggtatgccctcccccatgccatcctgcgtctggacctggctggccgggacctgactgactacctcatgaagatcctcaccgagcgcggctacagcttcaccaccacggccgagcgggaaatcgtgcgtgacattaaggagaagctgtgctacgtcgccctggacttcgagcaagagatggccacggctgcttccagctcctccctggagaagagctacgagctgcctgacggccaggtcatcaccattggcaatgagcggttccgctgccctgaggcactcttccagccttccttcctgggcatggagtcctgtggcatccacgaaactaccttcaactccatcatgaagtgtgacgtggacatccgcaaagacctgtacgccaacacagtgctgtctggcggcaccaccatgtaccctggcattgccgacaggatgcagaaggagatcactgccctggcacccagcacaatgaagatcaagatcattgctcctcctgagcgcaagtactccgtgtggatcggcggctccatcctggcctcgctgtccaccttccagcagatgtggatcagcaagcaggagtatgacgagtccggcccctccatcgtccaccgcaaatgcttctag
Sequence Length
1128
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
60
Molecular Weight
41,737 Da
NCBI Official Full Name
Homo sapiens actin, beta, mRNA
NCBI Official Synonym Full Names
actin beta
NCBI Official Symbol
ACTB
NCBI Official Synonym Symbols
BRWS1; PS1TP5BP1
NCBI Protein Information
actin, cytoplasmic 1
UniProt Protein Name
Actin, cytoplasmic 1
Protein Family
UniProt Gene Name
ACTB
UniProt Entry Name
ACTB_HUMAN

NCBI Description

This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins. [provided by RefSeq, Jul 2008]

Uniprot Description

ACTB: Actins are highly conserved proteins that are involved in various types of cell motility and are ubiquitously expressed in all eukaryotic cells. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to 4 others. Identified in a mRNP granule complex, at least composed of ACTB, ACTN4, DHX9, ERG, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPD, HNRNPL, HNRNPR, HNRNPU, HSPA1, HSPA8, IGF2BP1, ILF2, ILF3, NCBP1, NCL, PABPC1, PABPC4, PABPN1, RPLP0, RPS3, RPS3A, RPS4X, RPS8, RPS9, SYNCRIP, TROVE2, YBX1 and untranslated mRNAs. Component of the BAF complex, which includes at least actin (ACTB), ARID1A, ARID1B/BAF250, SMARCA2, SMARCA4/BRG1, ACTL6A/BAF53, ACTL6B/BAF53B, SMARCE1/BAF57 SMARCC1/BAF155, SMARCC2/BAF170, SMARCB1/SNF5/INI1, and one or more of SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C. In muscle cells, the BAF complex also contains DPF3. Found in a complex with XPO6, Ran, ACTB and PFN1. Component of the MLL5-L complex, at least composed of MLL5, STK38, PPP1CA, PPP1CB, PPP1CC, HCFC1, ACTB and OGT. Interacts with XPO6 and EMD. Interacts with ERBB2. Interacts with GCET2. Belongs to the actin family.

Protein type: Cytoskeletal; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 7p22

Cellular Component: cytoplasm; cytoskeleton; cytosol; extracellular space; focal adhesion; membrane; NuA4 histone acetyltransferase complex; nuclear chromatin; nucleoplasm; plasma membrane; protein complex; ribonucleoprotein complex

Molecular Function: identical protein binding; kinesin binding; nitric-oxide synthase binding; nucleosomal DNA binding; protein binding; structural constituent of cytoskeleton; Tat protein binding

Biological Process: ATP-dependent chromatin remodeling; cell motility; ephrin receptor signaling pathway; positive regulation of gene expression, epigenetic; retinal homeostasis; substantia nigra development; vascular endothelial growth factor receptor signaling pathway

Disease: Baraitser-winter Syndrome 1; Dystonia, Juvenile-onset

Research Articles on ACTB

Similar Products

Product Notes

The ACTB actb (Catalog #AAA1271952) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgatg atatcgccgc gctcgtcgtc gacaacggct ccggcatgtg caaggccggc ttcgcgggcg acgatgcccc ccgggccgtc ttcccctcca tcgtggggcg ccccaggcac cagggcgtga tggtgggcat gggtcagaag gattcctatg tgggcgacga ggcccagagc aagagaggca tcctcaccct gaagtacccc atcgagcacg gcatcgtcac caactgggac gacatggaga aaatctggca ccacaccttc tacaatgagc tgcgtgtggc tcccgaggag caccccgtgc tgctgaccga ggcccccctg aaccccaagg ccaaccgcga gaagatgacc cagatcatgt ttgagacctt caacacccca gccatgtacg ttgctatcca ggctgtgcta tccctgtacg cctctggccg taccactggc atcgtgatgg actccggtga cggggtcacc cacactgtgc ccatctacga ggggtatgcc ctcccccatg ccatcctgcg tctggacctg gctggccggg acctgactga ctacctcatg aagatcctca ccgagcgcgg ctacagcttc accaccacgg ccgagcggga aatcgtgcgt gacattaagg agaagctgtg ctacgtcgcc ctggacttcg agcaagagat ggccacggct gcttccagct cctccctgga gaagagctac gagctgcctg acggccaggt catcaccatt ggcaatgagc ggttccgctg ccctgaggca ctcttccagc cttccttcct gggcatggag tcctgtggca tccacgaaac taccttcaac tccatcatga agtgtgacgt ggacatccgc aaagacctgt acgccaacac agtgctgtct ggcggcacca ccatgtaccc tggcattgcc gacaggatgc agaaggagat cactgccctg gcacccagca caatgaagat caagatcatt gctcctcctg agcgcaagta ctccgtgtgg atcggcggct ccatcctggc ctcgctgtcc accttccagc agatgtggat cagcaagcag gagtatgacg agtccggccc ctccatcgtc caccgcaaat gcttctag. It is sometimes possible for the material contained within the vial of "ACTB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.