ACSS2 cdna clone
ACSS2 cDNA Clone
Gene Names
ACSS2; ACS; ACSA; ACAS2; ACECS; dJ1161H23.1
Synonyms
ACSS2; ACSS2 cDNA Clone; ACSS2 cdna clone
Sequence
atggggcttcctgaggagcgggtccggagcggcagcgggagccggggccaggaggaagctggagccggaggccgggcgcggagttggtctccgccgcccgaggtcagccgctccgcgcacgtcccctcgctgcagcgctaccgcgagctgcaccggcgctccgtggaggagccgcgggaattctggggagacattgccaaggaattttactggaagactccatgccctggcccattccttcggtacaactttgatgtgactaaagggaaaatctttattgagtggatgaaaggagcaactaccaacatctgctacaatgtactggatcgaaatgtccatgagaaaaagcttggagataaagttgctttttactgggagggcaatgagccaggggagaccactcagatcacataccatcagcttctggtccaagtgtgtcagttcagcaatgttctccgaaaacagggcattcagaagggggaccgagtggccatctacatgcctatgatcccagagcttgtggtggccatgctggcatgtgcccgcattggggctttgcactccattgtgtttgcaggcttctcttcagagtctctatgtgaacggatcttggattccagctgcagtcttctcatcactacagatgccttctacaggggggaaaagcttgtgaacctgaaggagctggctgacgaggccctgcagaagtgtcaggagaagggtttcccagtaagatgctgcattgtggtcaagcacctggggcgggcagagctcggcatgggtgactccaccagccagtcccccccaattaagaggtcatgcccagatgtgcagatctcatggaaccaagggattgacttgtggtggcatgagctcatgcaagaggcaggggatgagtgtgagcccgagtggtgtgatgccgaggacccactcttcatcctgtacaccagtggctccacaggcaaacccaagggtgtggttcacacagttgggggctacatgctctatgtagccacaaccttcaagtatgtgtttgacttccatgcagaggatgtgttctggtgcacggcagacattggttggatcactggtcattcctacgtcacctatgggccactggccaatggtgccaccagtgttttgtttgaggggattcccacatatccggacgtgaaccgcctgtggagcattgtggacaaatacaaggtgaccaagttctacacagcacccacagccatccgtctgctcatgaagtttggagatgagcctgtcaccaagcatagccgggcatccttgcaggtgttaggcacagtgggtgaacccatcaaccctgaggcctggctatggtaccaccgggtggtaggtgcccagcgctgccccatcgtggacaccttctggcaaacagagacaggtggccacatgttgactccccttcctggtgccacacccatgaaacccggttctgctactttcccattctttggtgtagctcctgcaatcctgaatgagtccggggaagagttggaaggtgaagctgaaggttatctggtgttcaagcagccctggccagggatcatgcgcacagtctatgggaaccacgaacgctttgagacaacctactttaagaagtttcctggatactatgttacaggagatggctgccagcgggaccaggatggctattactggatcactggcaggattgatgacatgctcaatgtatctggacacctgctgagtacagcagaggtggagtcagcacttgtggaacatgaggctgttgcagaggcagctgtggtgggccaccctcatcctgtgaagggtgaatgcctctactgctttttcaccttgtgtgatggccacaccttcagccccaagctcaccgaggagctcaagaagcagattagagaaaagattggccccattgccacaccagactacatccagaatgcacctggcttgcctaaaacccgctcagggaaaatcatgaggcgagtgcttcggaagattgctcagaatgaccatgacctcggggacatgtctactgtggctgacccatctgtcatcagtcacctcttcagccaccgctgcctgaccatccagtga
Sequence Length
2106
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
80,087 Da
NCBI Official Full Name
Homo sapiens acyl-CoA synthetase short-chain family member 2, mRNA
NCBI Official Synonym Full Names
acyl-CoA synthetase short-chain family member 2
NCBI Official Symbol
ACSS2
NCBI Official Synonym Symbols
ACS; ACSA; ACAS2; ACECS; dJ1161H23.1
NCBI Protein Information
acetyl-coenzyme A synthetase, cytoplasmic
UniProt Protein Name
Acetyl-coenzyme A synthetase, cytoplasmic
Protein Family
UniProt Gene Name
ACSS2
UniProt Synonym Gene Names
ACAS2; ACS; AceCS
UniProt Entry Name
ACSA_HUMAN
NCBI Description
This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Uniprot Description
ACSS2: Activates acetate so that it can be used for lipid synthesis or for energy generation. Monomer. Belongs to the ATP-dependent AMP-binding enzyme family.
Protein type: Carbohydrate Metabolism - propanoate; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Carbohydrate Metabolism - pyruvate; EC 6.2.1.1; Ligase
Chromosomal Location of Human Ortholog: 20q11.22
Cellular Component: cytoplasm; cytosol; intracellular membrane-bound organelle; nucleoplasm
Molecular Function: acetate-CoA ligase activity; AMP binding
Biological Process: ethanol oxidation; lipid biosynthetic process
Research Articles on ACSS2
Similar Products
Product Notes
The ACSS2 acss2 (Catalog #AAA1278626) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcttc ctgaggagcg ggtccggagc ggcagcggga gccggggcca ggaggaagct ggagccggag gccgggcgcg gagttggtct ccgccgcccg aggtcagccg ctccgcgcac gtcccctcgc tgcagcgcta ccgcgagctg caccggcgct ccgtggagga gccgcgggaa ttctggggag acattgccaa ggaattttac tggaagactc catgccctgg cccattcctt cggtacaact ttgatgtgac taaagggaaa atctttattg agtggatgaa aggagcaact accaacatct gctacaatgt actggatcga aatgtccatg agaaaaagct tggagataaa gttgcttttt actgggaggg caatgagcca ggggagacca ctcagatcac ataccatcag cttctggtcc aagtgtgtca gttcagcaat gttctccgaa aacagggcat tcagaagggg gaccgagtgg ccatctacat gcctatgatc ccagagcttg tggtggccat gctggcatgt gcccgcattg gggctttgca ctccattgtg tttgcaggct tctcttcaga gtctctatgt gaacggatct tggattccag ctgcagtctt ctcatcacta cagatgcctt ctacaggggg gaaaagcttg tgaacctgaa ggagctggct gacgaggccc tgcagaagtg tcaggagaag ggtttcccag taagatgctg cattgtggtc aagcacctgg ggcgggcaga gctcggcatg ggtgactcca ccagccagtc ccccccaatt aagaggtcat gcccagatgt gcagatctca tggaaccaag ggattgactt gtggtggcat gagctcatgc aagaggcagg ggatgagtgt gagcccgagt ggtgtgatgc cgaggaccca ctcttcatcc tgtacaccag tggctccaca ggcaaaccca agggtgtggt tcacacagtt gggggctaca tgctctatgt agccacaacc ttcaagtatg tgtttgactt ccatgcagag gatgtgttct ggtgcacggc agacattggt tggatcactg gtcattccta cgtcacctat gggccactgg ccaatggtgc caccagtgtt ttgtttgagg ggattcccac atatccggac gtgaaccgcc tgtggagcat tgtggacaaa tacaaggtga ccaagttcta cacagcaccc acagccatcc gtctgctcat gaagtttgga gatgagcctg tcaccaagca tagccgggca tccttgcagg tgttaggcac agtgggtgaa cccatcaacc ctgaggcctg gctatggtac caccgggtgg taggtgccca gcgctgcccc atcgtggaca ccttctggca aacagagaca ggtggccaca tgttgactcc ccttcctggt gccacaccca tgaaacccgg ttctgctact ttcccattct ttggtgtagc tcctgcaatc ctgaatgagt ccggggaaga gttggaaggt gaagctgaag gttatctggt gttcaagcag ccctggccag ggatcatgcg cacagtctat gggaaccacg aacgctttga gacaacctac tttaagaagt ttcctggata ctatgttaca ggagatggct gccagcggga ccaggatggc tattactgga tcactggcag gattgatgac atgctcaatg tatctggaca cctgctgagt acagcagagg tggagtcagc acttgtggaa catgaggctg ttgcagaggc agctgtggtg ggccaccctc atcctgtgaa gggtgaatgc ctctactgct ttttcacctt gtgtgatggc cacaccttca gccccaagct caccgaggag ctcaagaagc agattagaga aaagattggc cccattgcca caccagacta catccagaat gcacctggct tgcctaaaac ccgctcaggg aaaatcatga ggcgagtgct tcggaagatt gctcagaatg accatgacct cggggacatg tctactgtgg ctgacccatc tgtcatcagt cacctcttca gccaccgctg cctgaccatc cagtga. It is sometimes possible for the material contained within the vial of "ACSS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
