Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACOX1 cdna clone

ACOX1 cDNA Clone

Gene Names
ACOX1; ACOX; SCOX; PALMCOX
Synonyms
ACOX1; ACOX1 cDNA Clone; ACOX1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacccggacctgcgcagggagcgggattccgccagcttcaacccggagctgcttacacacatcctggacggcagccccgagaaaacccggcgccgccgagagatcgagaacatgatcctgaacgacccagacttccagcatgaggacttgaacttcctcactcgcagccagcgttatgaggtggctgtcaggaaaagtgccatcatggtgaagaagatgagggagtttggcatcgctgaccctgatgaaattatgtggtttaaaaattttgtgcaccgagggcggcctgagcctctggatcttcacttgggcatgttcctgcccaccttgcttcaccaggcaactgcggagcagcaggagcgcttcttcatgcccgcctggaacttggagatcattggcacttatgcccagacagagatgggtcatggaactcaccttcgaggcttggaaaccatagccacgtatgaccctgaaacccaggagttcattctcaacagtcctactgtgacctccattaaatggtggcctggtgggcttggaaagacttcaaatcatgcaatagttcttgcccagctcatcactaaggggaaatgctatggattacatgcctttatcgtacctattcgtgaaatcgggacccataagcctttgccaggaattaccgttggtgacatcggccccaaatttggttatgatgagatagacaatggctacctcaaaatggacaaccatcgtattcccagagaaaacatgctgatgaagtatgcccaggtgaagcctgatggcacatacgtgaaaccgctgagtaacaagctgacttacgggaccatggtgtttgtcaggtccttccttgtgggagaagctgctcgggctctgtctaaggcgtgcaccattgccatccgatacagcgctgtgaggcaccagtctgaaatgaagccaggtgaaccagaaccacagattttggattttcaaacccagcagtataaactctttccactcctggccactgcctatgccttccagtttgtgggcgcatacatgaaggagacctatcaccggattaacgaaggcattggtcaaggggacctgagtgaactgcctgagcttcatgccctcaccgctggactgaaggctttcacctcctggactgcaaacactggcattgaagcatgtcggatggcttgtggtgggcatggctattctcattgcagtggtcttccaaatatttatgtcaatttcaccccaagctgtacctttgagggagaaaacactgtcatgatgctccagacggctaggttcctgatgaaaagttatgatcaggtgcactcaggaaagttggtgtgtggcatggtgtcctatttgaacgacctgcccagtcagcgcatccagccacagcaggtagcagtctggccaaccatggtggatatcaacagccccgaaagcctaaccgaagcatataaactccgtgcagccagattagtagaaattgctgcaaaaaaccttcaaaaagaagtgattcacagaaaaagcaaggaggtagcttggaacctaacttctgttgaccttgttcgagcaagtgaggcacattgccactatgtggtagttaagctcttttcagaaaaactcctcaaaattcaagataaagccattcaagctgtcttaaggagtttatgtctgctgtattctctgtatggaatcagtcagaacgcgggggatttccttcaggggagcatcatgacagagcctcagattacacaagtaaaccagcgtgtaaaggagttactcactctgattcgctcagatgctgttgctttggttgatgcatttgattttcaggatgtgacacttggctctgtgcttggccgctatgatgggaatgtgtatgaaaacttgtttgagtgggctaagaactccccactgaacaaagcagaggtccacgaatcttacaagcacctgaagtcactgcagtccaagctctga
Sequence Length
1983
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
51
Molecular Weight
70,136 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A oxidase 1, palmitoyl, mRNA
NCBI Official Synonym Full Names
acyl-CoA oxidase 1
NCBI Official Symbol
ACOX1
NCBI Official Synonym Symbols
ACOX; SCOX; PALMCOX
NCBI Protein Information
peroxisomal acyl-coenzyme A oxidase 1
UniProt Protein Name
Peroxisomal acyl-coenzyme A oxidase 1
UniProt Gene Name
ACOX1
UniProt Synonym Gene Names
ACOX; AOX; SCOX
UniProt Entry Name
ACOX1_HUMAN

NCBI Description

The protein encoded by this gene is the first enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. It donates electrons directly to molecular oxygen, thereby producing hydrogen peroxide. Defects in this gene result in pseudoneonatal adrenoleukodystrophy, a disease that is characterized by accumulation of very long chain fatty acids. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

ACOX1: Catalyzes the desaturation of acyl-CoAs to 2-trans- enoyl-CoAs. Isoform 1 shows highest activity against medium-chain fatty acyl-CoAs and activity decreases with increasing chain length. Isoform 2 is active against a much broader range of substrates and shows activity towards very long-chain acyl-CoAs. Isoform 2 is twice as active as isoform 1 against 16-hydroxy- palmitoyl-CoA and is 25% more active against 1,16-hexadecanodioyl- CoA. Defects in ACOX1 are the cause of adrenoleukodystrophy pseudoneonatal (Pseudo-NALD); also known as peroxisomal acyl-CoA oxidase deficiency. Pseudo-NALD is a peroxisomal single-enzyme disorder. Clinical features include mental retardation, leukodystrophy, seizures, mild hepatomegaly, hearing deficit. Pseudo-NALD is characterized by increased plasma levels of very-long chain fatty cids, due to decreased or absent peroxisome acyl-CoA oxidase activity. Peroxisomes are intact and functioning. Belongs to the acyl-CoA oxidase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid Metabolism - unsaturated fatty acid biosynthesis; EC 1.3.3.6; Lipid Metabolism - fatty acid; Oxidoreductase; Lipid Metabolism - alpha-linolenic acid

Chromosomal Location of Human Ortholog: 17q25.1

Cellular Component: intracellular membrane-bound organelle; membrane; nucleolus; nucleoplasm; nucleus; peroxisomal matrix; peroxisome; plasma membrane

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; acyl-CoA oxidase activity; electron carrier activity; PDZ domain binding; protein N-terminus binding; receptor binding

Biological Process: fatty acid beta-oxidation using acyl-CoA dehydrogenase; fatty acid beta-oxidation using acyl-CoA oxidase; fatty acid oxidation; generation of precursor metabolites and energy; lipid metabolic process; prostaglandin metabolic process; very-long-chain fatty acid metabolic process

Disease: Peroxisomal Acyl-coa Oxidase Deficiency

Research Articles on ACOX1

Similar Products

Product Notes

The ACOX1 acox1 (Catalog #AAA1276783) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacccgg acctgcgcag ggagcgggat tccgccagct tcaacccgga gctgcttaca cacatcctgg acggcagccc cgagaaaacc cggcgccgcc gagagatcga gaacatgatc ctgaacgacc cagacttcca gcatgaggac ttgaacttcc tcactcgcag ccagcgttat gaggtggctg tcaggaaaag tgccatcatg gtgaagaaga tgagggagtt tggcatcgct gaccctgatg aaattatgtg gtttaaaaat tttgtgcacc gagggcggcc tgagcctctg gatcttcact tgggcatgtt cctgcccacc ttgcttcacc aggcaactgc ggagcagcag gagcgcttct tcatgcccgc ctggaacttg gagatcattg gcacttatgc ccagacagag atgggtcatg gaactcacct tcgaggcttg gaaaccatag ccacgtatga ccctgaaacc caggagttca ttctcaacag tcctactgtg acctccatta aatggtggcc tggtgggctt ggaaagactt caaatcatgc aatagttctt gcccagctca tcactaaggg gaaatgctat ggattacatg cctttatcgt acctattcgt gaaatcggga cccataagcc tttgccagga attaccgttg gtgacatcgg ccccaaattt ggttatgatg agatagacaa tggctacctc aaaatggaca accatcgtat tcccagagaa aacatgctga tgaagtatgc ccaggtgaag cctgatggca catacgtgaa accgctgagt aacaagctga cttacgggac catggtgttt gtcaggtcct tccttgtggg agaagctgct cgggctctgt ctaaggcgtg caccattgcc atccgataca gcgctgtgag gcaccagtct gaaatgaagc caggtgaacc agaaccacag attttggatt ttcaaaccca gcagtataaa ctctttccac tcctggccac tgcctatgcc ttccagtttg tgggcgcata catgaaggag acctatcacc ggattaacga aggcattggt caaggggacc tgagtgaact gcctgagctt catgccctca ccgctggact gaaggctttc acctcctgga ctgcaaacac tggcattgaa gcatgtcgga tggcttgtgg tgggcatggc tattctcatt gcagtggtct tccaaatatt tatgtcaatt tcaccccaag ctgtaccttt gagggagaaa acactgtcat gatgctccag acggctaggt tcctgatgaa aagttatgat caggtgcact caggaaagtt ggtgtgtggc atggtgtcct atttgaacga cctgcccagt cagcgcatcc agccacagca ggtagcagtc tggccaacca tggtggatat caacagcccc gaaagcctaa ccgaagcata taaactccgt gcagccagat tagtagaaat tgctgcaaaa aaccttcaaa aagaagtgat tcacagaaaa agcaaggagg tagcttggaa cctaacttct gttgaccttg ttcgagcaag tgaggcacat tgccactatg tggtagttaa gctcttttca gaaaaactcc tcaaaattca agataaagcc attcaagctg tcttaaggag tttatgtctg ctgtattctc tgtatggaat cagtcagaac gcgggggatt tccttcaggg gagcatcatg acagagcctc agattacaca agtaaaccag cgtgtaaagg agttactcac tctgattcgc tcagatgctg ttgctttggt tgatgcattt gattttcagg atgtgacact tggctctgtg cttggccgct atgatgggaa tgtgtatgaa aacttgtttg agtgggctaa gaactcccca ctgaacaaag cagaggtcca cgaatcttac aagcacctga agtcactgca gtccaagctc tga. It is sometimes possible for the material contained within the vial of "ACOX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.