Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACOT8 cdna clone

ACOT8 cDNA Clone

Gene Names
ACOT8; hTE; NAP1; PTE1; PTE2; PTE-1; PTE-2; HNAACTE; hACTE-III
Synonyms
ACOT8; ACOT8 cDNA Clone; ACOT8 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgtccccgcaggccccagaagatgggcagggctgtggcgaccgcggcgatccccctggggacctccgtagcgtcttggtcacgaccgtgctcaacctcgagccgctggacgaggatctcttcagaggaaggcattactgggtaccggccaagaggctgtttggtggtcagatcgtgggccaggccctggtggctgcagccaagtctgtgagtgaagacgtccacgtgcactccctgcactgctactttgttcgggcaggggacccgaagctgccagtactgtaccaagtggagcggacacgaacagggtcgagcttctcggtgcgctctgtgaaggccgtgcaacatgggaagcccatcttcatctgccaggcctccttccagcaggcccagcccagccccatgcagcaccagttctccatgcccactgtgccaccaccagaagagctgcttgactgtgagaccctcattgaccagtatttaagggaccctaacctccaaaagaggtacccattggcgctcaaccgaattgctgctcaggaggtccccattgagatcaagccagtaaacccatcccccctgagccagctgcagagaatggagcccaaacagatgttctgggtgcgagcccggggctatattggcgagggcgacatgaagatgcactgctgcgtggccgcctatatctccgactatgccttcttgggcactgcactgctgcctcaccagtggcagcacaaggtgcacttcatggtctcactggaccattccatgtggttccacgcccccttccgagctgaccactggatgctctatgaatgcgagagcccctgggccggtggctctcgggggctggtccatgggcggctgtggcgtcaggatggagtcctagctgtgacctgtgcccaggagggcgtgatccgagtgaagccccaggtctcagagagcaagctgtag
Sequence Length
960
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,914 Da
NCBI Official Full Name
Homo sapiens acyl-CoA thioesterase 8, mRNA
NCBI Official Synonym Full Names
acyl-CoA thioesterase 8
NCBI Official Symbol
ACOT8
NCBI Official Synonym Symbols
hTE; NAP1; PTE1; PTE2; PTE-1; PTE-2; HNAACTE; hACTE-III
NCBI Protein Information
acyl-coenzyme A thioesterase 8
UniProt Protein Name
Acyl-coenzyme A thioesterase 8
UniProt Gene Name
ACOT8
UniProt Synonym Gene Names
ACTEIII; PTE1; PTE2; Acyl-CoA thioesterase 8; PTE-1; hACTE-III; hACTEIII; hTE
UniProt Entry Name
ACOT8_HUMAN

NCBI Description

The protein encoded by this gene is a peroxisomal thioesterase that appears to be involved more in the oxidation of fatty acids rather than in their formation. The encoded protein can bind to the human immunodeficiency virus-1 protein Nef, and mediate Nef-induced down-regulation of CD4 in T-cells. [provided by RefSeq, Oct 2010]

Uniprot Description

ACOT8: Acyl-CoA thioesterases are a group of enzymes that catalyze the hydrolysis of acyl-CoAs to the free fatty acid and coenzyme A (CoASH), providing the potential to regulate intracellular levels of acyl-CoAs, free fatty acids and CoASH. May mediate Nef-induced down-regulation of CD4. Major thioesterase in peroxisomes. Competes with BAAT (Bile acid CoA: amino acid N- acyltransferase) for bile acid-CoA substrate (such as chenodeoxycholoyl-CoA). Shows a preference for medium-length fatty acyl-CoAs. May be involved in the metabolic regulation of peroxisome proliferation. Belongs to the C/M/P thioester hydrolase family.

Protein type: Hydrolase; EC 3.1.2.27

Chromosomal Location of Human Ortholog: 20q13.12

Cellular Component: peroxisomal matrix

Molecular Function: acetyl-CoA hydrolase activity; acyl-CoA hydrolase activity; CoA hydrolase activity; palmitoyl-CoA hydrolase activity; protein binding; receptor binding

Biological Process: acyl-CoA metabolic process; bile acid biosynthetic process; dicarboxylic acid catabolic process; fatty acid beta-oxidation using acyl-CoA oxidase; negative regulation of CD4 biosynthetic process; peroxisome fission

Research Articles on ACOT8

Similar Products

Product Notes

The ACOT8 acot8 (Catalog #AAA1275060) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtccc cgcaggcccc agaagatggg cagggctgtg gcgaccgcgg cgatccccct ggggacctcc gtagcgtctt ggtcacgacc gtgctcaacc tcgagccgct ggacgaggat ctcttcagag gaaggcatta ctgggtaccg gccaagaggc tgtttggtgg tcagatcgtg ggccaggccc tggtggctgc agccaagtct gtgagtgaag acgtccacgt gcactccctg cactgctact ttgttcgggc aggggacccg aagctgccag tactgtacca agtggagcgg acacgaacag ggtcgagctt ctcggtgcgc tctgtgaagg ccgtgcaaca tgggaagccc atcttcatct gccaggcctc cttccagcag gcccagccca gccccatgca gcaccagttc tccatgccca ctgtgccacc accagaagag ctgcttgact gtgagaccct cattgaccag tatttaaggg accctaacct ccaaaagagg tacccattgg cgctcaaccg aattgctgct caggaggtcc ccattgagat caagccagta aacccatccc ccctgagcca gctgcagaga atggagccca aacagatgtt ctgggtgcga gcccggggct atattggcga gggcgacatg aagatgcact gctgcgtggc cgcctatatc tccgactatg ccttcttggg cactgcactg ctgcctcacc agtggcagca caaggtgcac ttcatggtct cactggacca ttccatgtgg ttccacgccc ccttccgagc tgaccactgg atgctctatg aatgcgagag cccctgggcc ggtggctctc gggggctggt ccatgggcgg ctgtggcgtc aggatggagt cctagctgtg acctgtgccc aggagggcgt gatccgagtg aagccccagg tctcagagag caagctgtag. It is sometimes possible for the material contained within the vial of "ACOT8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.