ABHD10 cdna clone

ABHD10 cDNA Clone

Synonyms

ABHD10; ABHD10 cDNA Clone; ABHD10 cdna clone

Ordering
Cat. Num. AAA1266086 For Research Use Only!

Sequence

atggcggttgcgcgcttggcagctgtggcggcctgggtaccttgtcggagctggggctgggcagccgtccccttcggtccccaccgtggcctcagcgtgctgcttgcacggatacctcagcgggcgccacggtggctcccagcttgtagacaaaagacgtcactctcattccttaatcgaccagaccttccaaacctggcttataagaagctaaaaggcaaaagtccaggaattatcttcatccctggctatctttcttatatgaatggtacaaaagcgttggcgattgaggagttttgcaaatctctaggtcacgcctgcataaggtttgattactcaggagttggaagttcagatggtaactcagaggaaagcacactggggaaatggagaaaagatgttctttctataattgatgacttagctgatgggccacagattcttgttggatctagccttggagggtggcttatgcttcatgctgcaattgcacgaccagagaaggtcgtggctcttattggtgtagctacagctgcagataccttagtgacaaagtttaatcagcttcctgttgagctaaaaaaggaagtagagatgaaaggtgtgtggagcatgccatcaaaatactctgaagaaggagtttataacgttcagtacagtttcattaaagaagctgaacatcactgcttgttacatagcccaattcctgtgaactgccccataagattgctccatggcatgaaggatgacattgtaccttggcatacatcaatgcaggttgccgatcgagtactcagcacagatgtggatgtcatcctccgaaaacacagtgatcaccgaatgagggaaaaagcagacattcaacttcttgtttacactattgatgacttaattgataagctctcaactatagttaactag

Sequence Length

921

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

38197232

NCBI GeneID

55347

Molecular Weight

22,141 Da

NCBI Official Full Name

Homo sapiens abhydrolase domain containing 10, mRNA

NCBI Official Synonym Full Names

abhydrolase domain containing 10

NCBI Official Symbol

ABHD10

NCBI Protein Information

mycophenolic acid acyl-glucuronide esterase, mitochondrial

UniProt Protein Name

Mycophenolic acid acyl-glucuronide esterase, mitochondrial

Protein Family

Mycophenolic acid acyl-glucuronide esterase

UniProt Gene Name

ABHD10

UniProt Synonym Gene Names

Abhydrolase domain-containing protein 10

UniProt Entry Name

ABHDA_HUMAN

NCBI Description

This gene encodes a mitochondrially-localized enzyme that acts in liver cells as a hydrolase. The encoded protein removes glucuronide from mycophenolic acid acyl-glucuronide. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Uniprot Description

ABHD10: a predicted hydrolase of the alpha/beta hydrolase superfamily

Protein type: Protease; Mitochondrial; EC 3.1.1.93

Chromosomal Location of Human Ortholog: 3q13.2

Cellular Component: cytosol; mitochondrial matrix; mitochondrion

Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds

Biological Process: glucuronoside catabolic process

Research Articles on ABHD10

1. Which potently inhibited ABHD10 activity.

Similar Products

Product Notes

The ABHD10 abhd10 (Catalog #AAA1266086) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggttg cgcgcttggc agctgtggcg gcctgggtac cttgtcggag ctggggctgg gcagccgtcc ccttcggtcc ccaccgtggc ctcagcgtgc tgcttgcacg gatacctcag cgggcgccac ggtggctccc agcttgtaga caaaagacgt cactctcatt ccttaatcga ccagaccttc caaacctggc ttataagaag ctaaaaggca aaagtccagg aattatcttc atccctggct atctttctta tatgaatggt acaaaagcgt tggcgattga ggagttttgc aaatctctag gtcacgcctg cataaggttt gattactcag gagttggaag ttcagatggt aactcagagg aaagcacact ggggaaatgg agaaaagatg ttctttctat aattgatgac ttagctgatg ggccacagat tcttgttgga tctagccttg gagggtggct tatgcttcat gctgcaattg cacgaccaga gaaggtcgtg gctcttattg gtgtagctac agctgcagat accttagtga caaagtttaa tcagcttcct gttgagctaa aaaaggaagt agagatgaaa ggtgtgtgga gcatgccatc aaaatactct gaagaaggag tttataacgt tcagtacagt ttcattaaag aagctgaaca tcactgcttg ttacatagcc caattcctgt gaactgcccc ataagattgc tccatggcat gaaggatgac attgtacctt ggcatacatc aatgcaggtt gccgatcgag tactcagcac agatgtggat gtcatcctcc gaaaacacag tgatcaccga atgagggaaa aagcagacat tcaacttctt gtttacacta ttgatgactt aattgataag ctctcaacta tagttaacta g. It is sometimes possible for the material contained within the vial of "ABHD10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ABHD10 cdna clone