ABHD1 cdna clone
ABHD1 cDNA Clone
Gene Names
ABHD1; LABH1
Synonyms
ABHD1; ABHD1 cDNA Clone; ABHD1 cdna clone
Sequence
atgctgagctccttcctgagcccccagaatggcacctgggcagacaccttctctctgctcttggctcttgccgttgccctctacttgggctactactgggcatgtgtgcttcagaggcctcggctggtggctgggccgcagtttctggccttcctggagccacactgttccatcaccaccgagactttctacccaacgctgtggtgttttgaggggcgactacaaagcatcttccaagtcctcctgcagtctcagcccctagtcctttatcagagtgacatcctccaaacaccagatggaggccagctcctgctagactgggccaagcagcctgacagcagccaagaccctgatcctactacccagcccattgtgctgctgcttcctggcatcactggcagtagccaggagacatacgtcttgcacctagttaaccaagctctgagggatggctaccaggctgtcgtgtttaacaaccggggctgccgtggggaggaactgcggacccacagggctttttgtgccagcaatactgaagatctagagacagtcgtgaaccacataaagcatcgttatccccaagctccactgctggccgtgggcatctcttttggagggatactggtgctgaatcacctggcacaggccaggcaggctgcagggctggtggcagcactgactctgtctgcatgctgggattcctttgagaccactcgctccctggaaaccccactcaactcactgctcttcaatcagcccctcactgctgggctctgccaacttgtggaacgaaacagaaaggtgattgaaaaggtggtggacatagactttgtactacaggcccgtacaatccgccagtttgatgagcgctacacatctgtggcctttggatatcaagactgtgttacctactacaaagcagcaagccctagaaccaagatagatgccatccggatccctgtgctctatctcagtgcagcagatgaccccttctcccccgtctgtgcccttcccatacaggccgcccaacactccccctacgttgcgctgctcatcacagcccggggtggccacatcggcttcctggaagggctgctcccgtggcagcactggtacatgagccgcctcttgcatcagtacgccaaagccatcttccaggacccagaggggctgcctgacctcagggctctcttaccttctgaggacagaaacagctga
Sequence Length
1218
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,754 Da
NCBI Official Full Name
Homo sapiens abhydrolase domain containing 1, mRNA
NCBI Official Synonym Full Names
abhydrolase domain containing 1
NCBI Official Symbol
ABHD1
NCBI Official Synonym Symbols
LABH1
NCBI Protein Information
protein ABHD1
UniProt Protein Name
Protein ABHD1
Protein Family
UniProt Gene Name
ABHD1
UniProt Synonym Gene Names
Abhydrolase domain-containing protein 1
UniProt Entry Name
ABHD1_HUMAN
NCBI Description
This gene is a member of the AB hydrolase superfamily and encodes a protein with an alpha/beta hydrolase fold. This domain is common to a number of hydrolytic enzymes of widely differing phylogenetic origins and catalytic functions. [provided by RefSeq, Jul 2008]
Uniprot Description
ABHD1: a member of the AB hydrolase superfamily and encodes a protein with an alpha/beta hydrolase fold. This domain is common to a number of hydrolytic enzymes of widely differing phylogenetic origins and catalytic functions. [provided by RefSeq, Jul 2008]
Protein type: EC 3.1.1.-; Hydrolase; Membrane protein, integral
Chromosomal Location of Human Ortholog: 2p23.3
Molecular Function: protein binding
Research Articles on ABHD1
Similar Products
Product Notes
The ABHD1 abhd1 (Catalog #AAA1266115) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgagct ccttcctgag cccccagaat ggcacctggg cagacacctt ctctctgctc ttggctcttg ccgttgccct ctacttgggc tactactggg catgtgtgct tcagaggcct cggctggtgg ctgggccgca gtttctggcc ttcctggagc cacactgttc catcaccacc gagactttct acccaacgct gtggtgtttt gaggggcgac tacaaagcat cttccaagtc ctcctgcagt ctcagcccct agtcctttat cagagtgaca tcctccaaac accagatgga ggccagctcc tgctagactg ggccaagcag cctgacagca gccaagaccc tgatcctact acccagccca ttgtgctgct gcttcctggc atcactggca gtagccagga gacatacgtc ttgcacctag ttaaccaagc tctgagggat ggctaccagg ctgtcgtgtt taacaaccgg ggctgccgtg gggaggaact gcggacccac agggcttttt gtgccagcaa tactgaagat ctagagacag tcgtgaacca cataaagcat cgttatcccc aagctccact gctggccgtg ggcatctctt ttggagggat actggtgctg aatcacctgg cacaggccag gcaggctgca gggctggtgg cagcactgac tctgtctgca tgctgggatt cctttgagac cactcgctcc ctggaaaccc cactcaactc actgctcttc aatcagcccc tcactgctgg gctctgccaa cttgtggaac gaaacagaaa ggtgattgaa aaggtggtgg acatagactt tgtactacag gcccgtacaa tccgccagtt tgatgagcgc tacacatctg tggcctttgg atatcaagac tgtgttacct actacaaagc agcaagccct agaaccaaga tagatgccat ccggatccct gtgctctatc tcagtgcagc agatgacccc ttctcccccg tctgtgccct tcccatacag gccgcccaac actcccccta cgttgcgctg ctcatcacag cccggggtgg ccacatcggc ttcctggaag ggctgctccc gtggcagcac tggtacatga gccgcctctt gcatcagtac gccaaagcca tcttccagga cccagagggg ctgcctgacc tcagggctct cttaccttct gaggacagaa acagctga. It is sometimes possible for the material contained within the vial of "ABHD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
