Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABCF1 cdna clone

ABCF1 cDNA Clone

Gene Names
ABCF1; ABC27; ABC50
Synonyms
ABCF1; ABCF1 cDNA Clone; ABCF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgaaggcgcccaagcagcagccgccggagcccgagtggatcggggacggagagagcacgagcccatcagacaaagtggtgaagaaagggaagaaggacaagaagatcaaaaaaacgttctttgaagagctggcagtagaagataaacaggctggggaagaagagaaagtgctcaaggagaaggagcagcagcagcagcaacagcaacagcagcaaaaaaaaaagcgagatacccgaaaaggcaggcggaagaaggatgtggatgatgatggagaagagaaagagctcatggagcgtcttaagaagctctcagtgccaaccagtgatgaggaggatgaagtacccgccccaaaaccccgcggagggaagaaaaccaagggtggtaatgtttttgcagccctgattcaggatcagagtgaggaagaggaggaggaagaaaaacatcctcctaagcctgccaagccggagaagaatcggatcaataaggccgtacctgaggaacagcagcctgcactcaagggcaaaaagggaaaggaagagaagtcaaaagggaaggctaagcctcaaaataaattcgctgctctggacaatgaagaggaggataaagaagaagaaattataaaggaaaaggagcctcccaaacaagggaaggagaaggccaagaaggcagagcagggttcagaggaagaaggagaaggggaagaagaggaggaggaaggaggagagtctaaggcagatgatccctatgctcatcttagcaaaaaggagaagaaaaagctgaaaaaacagatggagtatgagcgccaagtggcttcattaaaagcagccaatgcagctgaaaatgacttctccgtgtcccaggcggagatgtcctcccgccaagccatgttagaaaatgcatctgacatcaagctggagaagttcagcatctccgctcatggcaaggagctgttcgtcaatgcagacctgtacattgtagccggccgccgctacgggctggtaggacccaatggcaagggcaagaccacactcctcaagcacattgccaaccgagccctgagcatccctcccaacattgatgtgttgctgtgtgagcaggaggtggtagcagatgagacaccagcagtccaggctgttcttcgagctgacaccaagcgattgaagctgctggaagaggagcggcggcttcagggacagctggaacaaggggatgacacagctgctgagaggctagagaaggtgtatgaggaattgcgggccactggggcggcagctgcagaggccaaagcacggcggatcctggctggcctgggctttgaccctgaaatgcagaatcgacccacacagaagttctcagggggctggcgcatgcgtgtctccctggccagggcactgttcatggagcccacactgctgatgctggatgagcccaccaaccacctggacctcaacgctgtcatctggcttaataactacctccagggctggcggaagaccttgctgatcgtctcccatgaccagggcttcttggatgatgtctgcactgatatcatccacctcgatgcccagcggctccactactataggggcaattacatgaccttcaaaaagatgtaccagcagaagcagaaagaactgctgaaacagtatgagaagcaagagaaaaagctgaaggagctgaaggcaggcgggaagtccaccaagcaggcggaaaaacaaacgaaggaagccctgactcggaagcagcagaaatgccgacggaaaaaccaagatgaggaatcccaggaggcccctgagctcctgaagcgccctaaggagtacactgtgcgcttcacttttccagaccccccaccactcagccctccagtgctgggtctgcatggtgtgacattcggctaccagggacagaaaccactctttaagaacttggattttggcatcgacatggattcaaggatttgcattgtgggccctaatggtgtggggaagagtacgctactcctgctgctgactggcaagctgacaccgacccatggggaaatgagaaagaaccaccggctgaaaattggcttcttcaaccagcagtatgcagagcagctgcgcatggaggagacgcccactgagtacctgcagcggggcttcaacctgccctaccaggatgcccgcaagtgcctgggccgcttcggcctggagagtcacgcccacaccatccagatctgcaaactctctggtggtcagaaggcgcgagttgtgtttgctgagctggcctgtcgggaacctgatgtcctcatcttggacgagccaaccaataacctggacatagagtctattgatgctctaggggaggccatcaatgaatacaagggtgctgtgatcgttgtcagccatgatgcccgactcatcacagaaaccaattgccagctgtgggtggtggaggagcagagtgttagccaaatcgatggtgactttgaagactacaagcgggaggtgttggaggccctgggtgaagtcatggtcagccggccccgagagtga
Sequence Length
2538
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
23
Molecular Weight
91,680 Da
NCBI Official Full Name
Homo sapiens ATP-binding cassette, sub-family F (GCN20), member 1, mRNA
NCBI Official Synonym Full Names
ATP binding cassette subfamily F member 1
NCBI Official Symbol
ABCF1
NCBI Official Synonym Symbols
ABC27; ABC50
NCBI Protein Information
ATP-binding cassette sub-family F member 1
UniProt Protein Name
ATP-binding cassette sub-family F member 1
Protein Family
UniProt Gene Name
ABCF1
UniProt Synonym Gene Names
ABC50
UniProt Entry Name
ABCF1_HUMAN

NCBI Description

The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the GCN20 subfamily. Unlike other members of the superfamily, this protein lacks the transmembrane domains which are characteristic of most ABC transporters. This protein may be regulated by tumor necrosis factor-alpha and play a role in enhancement of protein synthesis and the inflammation process. [provided by RefSeq, Jul 2008]

Uniprot Description

ABCF1: Isoform 2 is required for efficient Cap- and IRES- mediated mRNA translation initiation. Isoform 2 is not involved in the ribosome biogenesis. Belongs to the ABC transporter superfamily. ABCF family. EF3 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; Translation

Chromosomal Location of Human Ortholog: 6p21.33

Cellular Component: cytoplasm; cytosol; membrane

Molecular Function: protein binding; translation factor activity, nucleic acid binding

Biological Process: inflammatory response; translation; transmembrane transport

Research Articles on ABCF1

Similar Products

Product Notes

The ABCF1 abcf1 (Catalog #AAA1273239) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgaagg cgcccaagca gcagccgccg gagcccgagt ggatcgggga cggagagagc acgagcccat cagacaaagt ggtgaagaaa gggaagaagg acaagaagat caaaaaaacg ttctttgaag agctggcagt agaagataaa caggctgggg aagaagagaa agtgctcaag gagaaggagc agcagcagca gcaacagcaa cagcagcaaa aaaaaaagcg agatacccga aaaggcaggc ggaagaagga tgtggatgat gatggagaag agaaagagct catggagcgt cttaagaagc tctcagtgcc aaccagtgat gaggaggatg aagtacccgc cccaaaaccc cgcggaggga agaaaaccaa gggtggtaat gtttttgcag ccctgattca ggatcagagt gaggaagagg aggaggaaga aaaacatcct cctaagcctg ccaagccgga gaagaatcgg atcaataagg ccgtacctga ggaacagcag cctgcactca agggcaaaaa gggaaaggaa gagaagtcaa aagggaaggc taagcctcaa aataaattcg ctgctctgga caatgaagag gaggataaag aagaagaaat tataaaggaa aaggagcctc ccaaacaagg gaaggagaag gccaagaagg cagagcaggg ttcagaggaa gaaggagaag gggaagaaga ggaggaggaa ggaggagagt ctaaggcaga tgatccctat gctcatctta gcaaaaagga gaagaaaaag ctgaaaaaac agatggagta tgagcgccaa gtggcttcat taaaagcagc caatgcagct gaaaatgact tctccgtgtc ccaggcggag atgtcctccc gccaagccat gttagaaaat gcatctgaca tcaagctgga gaagttcagc atctccgctc atggcaagga gctgttcgtc aatgcagacc tgtacattgt agccggccgc cgctacgggc tggtaggacc caatggcaag ggcaagacca cactcctcaa gcacattgcc aaccgagccc tgagcatccc tcccaacatt gatgtgttgc tgtgtgagca ggaggtggta gcagatgaga caccagcagt ccaggctgtt cttcgagctg acaccaagcg attgaagctg ctggaagagg agcggcggct tcagggacag ctggaacaag gggatgacac agctgctgag aggctagaga aggtgtatga ggaattgcgg gccactgggg cggcagctgc agaggccaaa gcacggcgga tcctggctgg cctgggcttt gaccctgaaa tgcagaatcg acccacacag aagttctcag ggggctggcg catgcgtgtc tccctggcca gggcactgtt catggagccc acactgctga tgctggatga gcccaccaac cacctggacc tcaacgctgt catctggctt aataactacc tccagggctg gcggaagacc ttgctgatcg tctcccatga ccagggcttc ttggatgatg tctgcactga tatcatccac ctcgatgccc agcggctcca ctactatagg ggcaattaca tgaccttcaa aaagatgtac cagcagaagc agaaagaact gctgaaacag tatgagaagc aagagaaaaa gctgaaggag ctgaaggcag gcgggaagtc caccaagcag gcggaaaaac aaacgaagga agccctgact cggaagcagc agaaatgccg acggaaaaac caagatgagg aatcccagga ggcccctgag ctcctgaagc gccctaagga gtacactgtg cgcttcactt ttccagaccc cccaccactc agccctccag tgctgggtct gcatggtgtg acattcggct accagggaca gaaaccactc tttaagaact tggattttgg catcgacatg gattcaagga tttgcattgt gggccctaat ggtgtgggga agagtacgct actcctgctg ctgactggca agctgacacc gacccatggg gaaatgagaa agaaccaccg gctgaaaatt ggcttcttca accagcagta tgcagagcag ctgcgcatgg aggagacgcc cactgagtac ctgcagcggg gcttcaacct gccctaccag gatgcccgca agtgcctggg ccgcttcggc ctggagagtc acgcccacac catccagatc tgcaaactct ctggtggtca gaaggcgcga gttgtgtttg ctgagctggc ctgtcgggaa cctgatgtcc tcatcttgga cgagccaacc aataacctgg acatagagtc tattgatgct ctaggggagg ccatcaatga atacaagggt gctgtgatcg ttgtcagcca tgatgcccga ctcatcacag aaaccaattg ccagctgtgg gtggtggagg agcagagtgt tagccaaatc gatggtgact ttgaagacta caagcgggag gtgttggagg ccctgggtga agtcatggtc agccggcccc gagagtga. It is sometimes possible for the material contained within the vial of "ABCF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.