Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AATF cdna clone

AATF cDNA Clone

Gene Names
AATF; DED; BFR2; CHE1; CHE-1
Synonyms
AATF; AATF cDNA Clone; AATF cdna clone
Ordering
For Research Use Only!
Sequence
atggcggggccgcagcccctggcgctgcaactggaacagttgttgaacccgcgaccaagcgaggcggaccctgaagcggaccccgaggaagccactgctgccagggtgattgacaggtttgatgaaggggaagatggggaaggtgatttcctagtagtgggtagcattagaaaactggcatcagcctccctcttggacacggacaaaaggtattgcggcaaaaccacctctagaaaagcatggaatgaagaccattgggagcagactctgccaggatcgtctgatgaggaaatatctgatgaggaagggtctggagatgaagattcagagggactgggtctggaggaatatgatgaggacgacctgggtgctgctgaggaacaggagtgtggtgatcacagggagagcaagaagagcagaagccactctgcaaaaacaccgggcttcagtgtccagagtatcagtgactttgagaaatttaccaagggaatggatgaccttgggagcagtgaggaggaggaagacgaagagagtggcatggaagaaggggatgacgcggaagactcccaaggcgagagtgaggaagacagggctggagatagaaacagtgaggatgatggtgtggtgatgaccttctctagtgtcaaagtttctgaggaagtggagaaaggaagagccgtgaagaaccagatagcactgtgggaccagctcttggaaggaaggatcaaactacaaaaagctctgttgaccaccaaccagcttcctcaaccagatgttttcccattgttcaaggacaaaggtggcccagaattttccagtgccctgaaaaatagtcacaaggcacttaaagcattgttgaggtcattggtaggtcttcaggaagagttgcttttccagtacccagacactagatatctagtagatgggacaaagcccaatgcgggaagtgaggagatttctagtgaagatgatgagctggtagaagagaagaagcagcaacgaagaagggtccctgcaaagaggaagctggagatggaggactatcccagcttcatggcaaagcgctttgccgactttacagtctacaggaaccgcacacttcagaaatggcacgataagaccaaactggcttctggaaaactggggaagggttttggtgcctttgaacgctcaatcttgactcagatcgaccatattctgatggacaaagagagattacttcgaaggacacagaccaagcgctctgtctatcgagttcttggcaaacctgagccagcagctcagcctgtcccagagagtttgccaggggaaccggagatccttcctcaagcccctgctaatgctcatctgaaggacttggatgaagaaatctttgatgatgatgacttttaccaccagctccttcgagaactcatagaacggaagaccagctccttggatcccaacgatcaggtggccatgggaaggcagtggcttgcaatccagaagttacgaagcaaaatccacaaaaaagtagataggaaagccagcaaaggcaggaaacttcggtttcatgtccttagcaagctactgagtttcatggcacctattgaccatactacaatgaatgatgatgccaggacagaactgtaccgctctctttttggccagctccaccctcccgacgaaggccacggggattga
Sequence Length
1683
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,133 Da
NCBI Official Full Name
Homo sapiens apoptosis antagonizing transcription factor, mRNA
NCBI Official Synonym Full Names
apoptosis antagonizing transcription factor
NCBI Official Symbol
AATF
NCBI Official Synonym Symbols
DED; BFR2; CHE1; CHE-1
NCBI Protein Information
protein AATF
UniProt Protein Name
Protein AATF
Protein Family
UniProt Gene Name
AATF
UniProt Synonym Gene Names
CHE1; DED
UniProt Entry Name
AATF_HUMAN

NCBI Description

The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]

Uniprot Description

AATF: May function as a general inhibitor of the histone deacetylase HDAC1. Binding to the pocket region of RB1 may displace HDAC1 from RB1/E2F complexes, leading to activation of E2F target genes and cell cycle progression. Conversely, displacement of HDAC1 from SP1 bound to the CDKN1A promoter leads to increased expression of this CDK inhibitor and blocks cell cycle progression. Also antagonizes PAWR mediated induction of aberrant amyloid peptide production in Alzheimer disease (presenile and senile dementia), although the molecular basis for this phenomenon has not been described to date. Belongs to the AATF family.

Protein type: Transcription factor; RNA-binding; Nucleolus

Chromosomal Location of Human Ortholog: 17q12

Cellular Component: centrosome; cytoplasm; focal adhesion; nucleolus; nucleus

Molecular Function: leucine zipper domain binding; protein binding

Biological Process: negative regulation of apoptosis; negative regulation of superoxide release; positive regulation of transcription from RNA polymerase II promoter; response to DNA damage stimulus

Research Articles on AATF

Similar Products

Product Notes

The AATF aatf (Catalog #AAA1275193) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggggc cgcagcccct ggcgctgcaa ctggaacagt tgttgaaccc gcgaccaagc gaggcggacc ctgaagcgga ccccgaggaa gccactgctg ccagggtgat tgacaggttt gatgaagggg aagatgggga aggtgatttc ctagtagtgg gtagcattag aaaactggca tcagcctccc tcttggacac ggacaaaagg tattgcggca aaaccacctc tagaaaagca tggaatgaag accattggga gcagactctg ccaggatcgt ctgatgagga aatatctgat gaggaagggt ctggagatga agattcagag ggactgggtc tggaggaata tgatgaggac gacctgggtg ctgctgagga acaggagtgt ggtgatcaca gggagagcaa gaagagcaga agccactctg caaaaacacc gggcttcagt gtccagagta tcagtgactt tgagaaattt accaagggaa tggatgacct tgggagcagt gaggaggagg aagacgaaga gagtggcatg gaagaagggg atgacgcgga agactcccaa ggcgagagtg aggaagacag ggctggagat agaaacagtg aggatgatgg tgtggtgatg accttctcta gtgtcaaagt ttctgaggaa gtggagaaag gaagagccgt gaagaaccag atagcactgt gggaccagct cttggaagga aggatcaaac tacaaaaagc tctgttgacc accaaccagc ttcctcaacc agatgttttc ccattgttca aggacaaagg tggcccagaa ttttccagtg ccctgaaaaa tagtcacaag gcacttaaag cattgttgag gtcattggta ggtcttcagg aagagttgct tttccagtac ccagacacta gatatctagt agatgggaca aagcccaatg cgggaagtga ggagatttct agtgaagatg atgagctggt agaagagaag aagcagcaac gaagaagggt ccctgcaaag aggaagctgg agatggagga ctatcccagc ttcatggcaa agcgctttgc cgactttaca gtctacagga accgcacact tcagaaatgg cacgataaga ccaaactggc ttctggaaaa ctggggaagg gttttggtgc ctttgaacgc tcaatcttga ctcagatcga ccatattctg atggacaaag agagattact tcgaaggaca cagaccaagc gctctgtcta tcgagttctt ggcaaacctg agccagcagc tcagcctgtc ccagagagtt tgccagggga accggagatc cttcctcaag cccctgctaa tgctcatctg aaggacttgg atgaagaaat ctttgatgat gatgactttt accaccagct ccttcgagaa ctcatagaac ggaagaccag ctccttggat cccaacgatc aggtggccat gggaaggcag tggcttgcaa tccagaagtt acgaagcaaa atccacaaaa aagtagatag gaaagccagc aaaggcagga aacttcggtt tcatgtcctt agcaagctac tgagtttcat ggcacctatt gaccatacta caatgaatga tgatgccagg acagaactgt accgctctct ttttggccag ctccaccctc ccgacgaagg ccacggggat tga. It is sometimes possible for the material contained within the vial of "AATF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.