Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

F2 cdna clone

F2 cDNA Clone

Gene Names
F2; PT; THPH1; RPRGL2
Synonyms
F2; F2 cDNA Clone; F2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcacgtccgaggcttgcagctgcctggctgcctggccctggctgccctgtgtagccttgtgcacagccagcatgtgttcctggctcctcagcaagcacggtcgctgctccagcgggtccggcgagccaacaccttcttggaggaggtgcgcaagggcaacctggagcgagagtgcgtggaggagacgtgcagctacgaggaggccttcgaggctctggagtcctccacggctacggatgtgttctgggccaagtacacagcttgtgagacagcgaggacgcctcgagataagcttgctgcatgtctggaaggtaactgtgctgagggtctgggtacgaactaccgagggcatgtgaacatcacccggtcaggcattgagtgccagctatggaggagtcgctacccacataagcctgaaatcaactccactacccatcctggggccgacctacaggagaatttctgccgcaaccccgacagcagcaccacgggaccctggtgctacactacagaccccaccgtgaggaggcaggaatgcagcatccctgtctgtggccaggatcaagtcactgtagcgatgactccacgctccgaaggctccagtgtgaatctgtcacctccattggagcagtgtgtccctgatcgggggcagcagtaccaggggcgcctggcggtgaccacacatgggctcccctgcctggcctgggccagcgcacaggccaaggccctgagcaagcaccaggacttcaactcagctgtgcagctggtggagaacttctgccgcaacccagacggggatgaggagggcgcgtggtgctatgtggccgggaagcctggcgactttgggtactgcgacctcaactattgtgaggaggccgtggaggaggagacaggagatgggctggatgaggactcagacagggccatcgaagggcgtaccgccaccagtgagtaccagactttcttcaatccgaggacctttggctcgggagaggcagactgtgggctgcgacctctgttcgagaagaagtcgctggaggacaaaaccgaaagagagctcctggaatcctacatcgacgggcgcattgtggagggctcggatgcagagatcggcatgtcaccttggcaggtgatgcttttccggaagagtccccaggagctgctgtgtggggccagcctcatcagtgaccgctgggtcctcaccgccgcccactgcctcctgtacccgccctgggacaagaacttcaccgagaatgaccttctggtgcgcattggcaagcactcccgcaccaggtacgagcgaaacattgaaaagatatccatgttggaaaagatctacatccaccccaggtacaactggcgggagaacctggaccgggacattgccctgatgaagctgaagaagcctgttgccttcagtgactacattcaccctgtgtgtctgcccgacagggagacggcagccagcttgctccaggctggatacaaggggcgggtgacaggctggggcaacctgaaggagacgtggacagccaacgttggtaaggggcagcccagtgtcctgcaggtggtgaacctgcccattgtggagcggccggtctgcaaggactccacccggatccgcatcactgacaacatgttctgtgctggttacaagcctgatgaagggaaacgaggggatgcctgtgaaggtgacagtgggggaccctttgtcatgaagagcccctttaacaaccgctggtatcaaatgggcatcgtctcatggggtgaaggctgtgaccgggatgggaaatatggcttctacacacatgtgttccgcctgaagaagtggatacagaaggtcattgatcagtttggagagtag
Sequence Length
1869
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,037 Da
NCBI Official Full Name
Homo sapiens coagulation factor II (thrombin), mRNA
NCBI Official Synonym Full Names
coagulation factor II, thrombin
NCBI Official Symbol
F2
NCBI Official Synonym Symbols
PT; THPH1; RPRGL2
NCBI Protein Information
prothrombin
UniProt Protein Name
Prothrombin
Protein Family
UniProt Gene Name
F2
UniProt Entry Name
THRB_HUMAN

NCBI Description

Coagulation factor II is proteolytically cleaved to form thrombin in the first step of the coagulation cascade which ultimately results in the stemming of blood loss. F2 also plays a role in maintaining vascular integrity during development and postnatal life. Peptides derived from the C-terminus of this protein have antimicrobial activity against E. coli and P. aeruginosa. Mutations in F2 lead to various forms of thrombosis and dysprothrombinemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]

Uniprot Description

prothrombin: Thrombin, which cleaves bonds after Arg and Lys, converts fibrinogen to fibrin and activates factors V, VII, VIII, XIII, and, in complex with thrombomodulin, protein C. Functions in blood homeostasis, inflammation and wound healing. Defects in F2 are the cause of factor II deficiency (FA2D). It is a very rare blood coagulation disorder characterized by mucocutaneous bleeding symptoms. The severity of the bleeding manifestations correlates with blood factor II levels. Genetic variations in F2 may be a cause of susceptibility to ischemic stroke (ISCHSTR); also known as cerebrovascular accident or cerebral infarction. A stroke is an acute neurologic event leading to death of neural tissue of the brain and resulting in loss of motor, sensory and/or cognitive function. Ischemic strokes, resulting from vascular occlusion, is considered to be a highly complex disease consisting of a group of heterogeneous disorders with multiple genetic and environmental risk factors. Defects in F2 are the cause of thrombophilia due to thrombin defect (THPH1). It is a multifactorial disorder of hemostasis characterized by abnormal platelet aggregation in response to various agents and recurrent thrombi formation. A common genetic variation in the 3-prime untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increased risk of venous thrombosis. Defects in F2 are associated with susceptibility to pregnancy loss, recurrent, type 2 (RPRGL2). A common complication of pregnancy, resulting in spontaneous abortion before the fetus has reached viability. The term includes all miscarriages from the time of conception until 24 weeks of gestation. Recurrent pregnancy loss is defined as 3 or more consecutive spontaneous abortions. Belongs to the peptidase S1 family.

Protein type: Apoptosis; EC 3.4.21.5; Protease; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 11p11

Cellular Component: endoplasmic reticulum lumen; extracellular region; extracellular space; Golgi lumen; plasma membrane

Molecular Function: growth factor activity; protein binding; receptor binding; serine-type endopeptidase activity

Biological Process: blood coagulation; blood coagulation, intrinsic pathway; cell surface receptor linked signal transduction; cellular protein metabolic process; cytosolic calcium ion homeostasis; ER to Golgi vesicle-mediated transport; fibrinolysis; leukocyte migration; multicellular organismal development; negative regulation of astrocyte differentiation; negative regulation of fibrinolysis; negative regulation of proteolysis; peptidyl-glutamic acid carboxylation; platelet activation; positive regulation of blood coagulation; positive regulation of collagen biosynthetic process; positive regulation of protein amino acid phosphorylation; positive regulation of release of sequestered calcium ion into cytosol; proteolysis; regulation of blood coagulation; response to wounding; signal peptide processing

Disease: Pregnancy Loss, Recurrent, Susceptibility To, 2; Prothrombin Deficiency, Congenital; Stroke, Ischemic; Thrombophilia Due To Thrombin Defect

Research Articles on F2

Similar Products

Product Notes

The F2 f2 (Catalog #AAA7046718) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcacg tccgaggctt gcagctgcct ggctgcctgg ccctggctgc cctgtgtagc cttgtgcaca gccagcatgt gttcctggct cctcagcaag cacggtcgct gctccagcgg gtccggcgag ccaacacctt cttggaggag gtgcgcaagg gcaacctgga gcgagagtgc gtggaggaga cgtgcagcta cgaggaggcc ttcgaggctc tggagtcctc cacggctacg gatgtgttct gggccaagta cacagcttgt gagacagcga ggacgcctcg agataagctt gctgcatgtc tggaaggtaa ctgtgctgag ggtctgggta cgaactaccg agggcatgtg aacatcaccc ggtcaggcat tgagtgccag ctatggagga gtcgctaccc acataagcct gaaatcaact ccactaccca tcctggggcc gacctacagg agaatttctg ccgcaacccc gacagcagca ccacgggacc ctggtgctac actacagacc ccaccgtgag gaggcaggaa tgcagcatcc ctgtctgtgg ccaggatcaa gtcactgtag cgatgactcc acgctccgaa ggctccagtg tgaatctgtc acctccattg gagcagtgtg tccctgatcg ggggcagcag taccaggggc gcctggcggt gaccacacat gggctcccct gcctggcctg ggccagcgca caggccaagg ccctgagcaa gcaccaggac ttcaactcag ctgtgcagct ggtggagaac ttctgccgca acccagacgg ggatgaggag ggcgcgtggt gctatgtggc cgggaagcct ggcgactttg ggtactgcga cctcaactat tgtgaggagg ccgtggagga ggagacagga gatgggctgg atgaggactc agacagggcc atcgaagggc gtaccgccac cagtgagtac cagactttct tcaatccgag gacctttggc tcgggagagg cagactgtgg gctgcgacct ctgttcgaga agaagtcgct ggaggacaaa accgaaagag agctcctgga atcctacatc gacgggcgca ttgtggaggg ctcggatgca gagatcggca tgtcaccttg gcaggtgatg cttttccgga agagtcccca ggagctgctg tgtggggcca gcctcatcag tgaccgctgg gtcctcaccg ccgcccactg cctcctgtac ccgccctggg acaagaactt caccgagaat gaccttctgg tgcgcattgg caagcactcc cgcaccaggt acgagcgaaa cattgaaaag atatccatgt tggaaaagat ctacatccac cccaggtaca actggcggga gaacctggac cgggacattg ccctgatgaa gctgaagaag cctgttgcct tcagtgacta cattcaccct gtgtgtctgc ccgacaggga gacggcagcc agcttgctcc aggctggata caaggggcgg gtgacaggct ggggcaacct gaaggagacg tggacagcca acgttggtaa ggggcagccc agtgtcctgc aggtggtgaa cctgcccatt gtggagcggc cggtctgcaa ggactccacc cggatccgca tcactgacaa catgttctgt gctggttaca agcctgatga agggaaacga ggggatgcct gtgaaggtga cagtggggga ccctttgtca tgaagagccc ctttaacaac cgctggtatc aaatgggcat cgtctcatgg ggtgaaggct gtgaccggga tgggaaatat ggcttctaca cacatgtgtt ccgcctgaag aagtggatac agaaggtcat tgatcagttt ggagagtag. It is sometimes possible for the material contained within the vial of "F2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.