TWISTNB cdna clone
TWISTNB cDNA Clone
Synonyms
TWISTNB; TWISTNB cDNA Clone; TWISTNB cdna clone
Sequence
atggctgcaggttgctcagaggcgccgcggccagcggcggcttctgatgggtctctggtagggcaggctggcgtcctgccttgcctagagttgccgacttatgccgctgcttgtgcgctggtgaacagtcgctactcatgcctggtggccgggccgcaccaaaggcacatcgcgctgtcgccccgctaccttaacaggaaacgcaccggcattcgagaacagcttgatgcggagctccttcgctattctgagagccttttaggtgtccctattgcatatgataacatcaaagttgtgggagagcttggagatatttatgatgatcaaggacacattcatcttaacattgaagccgattttgttattttctgccctgaaccagggcagaagcttatgggtatagttaataaagtgtcttctagccacattggctgtttagtacatgggtgtttcaatgcctccattcctaaacctgagcagttgtcagctgagcagtggcaaaccatggagataaacatgggtgatgaactagaatttgaagtatttcgtttagactcagatgctgctggagtattctgcattcggggaaaactaaatatcacaagtttacaattcaagcgctctgaagtttctgaagaagttacagaaaatggcactgaggaagctgctaaaaaacctaaaaagaagaaaaagaagaaagacccagagacatatgaagtggacagtggtaccacaaagctagcagatgatgcagatgacactccaatggaagagtcagccctgcagaatactaataatgcgaatggcatctgggaggaggagccaaagaaaaagaagaagaagaaaaagcaccaggaagttcaggaccaggaccctgttttccaaggcagtgactccagtggttaccaaagtgaccataaaaagaaaaaaaagaaaagaaaacacagtgaagaggccgaatttaccccacctttgaaatgctcaccaaaaagaaaagggaaaagtaattttctttag
Sequence Length
1017
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,432 Da
NCBI Official Full Name
Homo sapiens TWIST neighbor, mRNA
NCBI Official Synonym Full Names
TWIST neighbor
NCBI Official Symbol
TWISTNB
NCBI Protein Information
DNA-directed RNA polymerase I subunit RPA43
UniProt Protein Name
DNA-directed RNA polymerase I subunit RPA43
UniProt Gene Name
TWISTNB
UniProt Entry Name
RPA43_HUMAN
Uniprot Description
TWISTNB: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase I which synthesizes ribosomal RNA precursors. Through its association with RRN3/TIF-IA may be involved in recruitment of Pol I to rDNA promoters. Belongs to the eukaryotic RPA43 RNA polymerase subunit family.
Protein type: Nucleolus
Chromosomal Location of Human Ortholog: 7p21.1
Cellular Component: DNA-directed RNA polymerase I complex; microtubule cytoskeleton; nucleolus; nucleoplasm; nucleus
Biological Process: positive regulation of gene expression, epigenetic; RNA elongation from RNA polymerase I promoter; termination of RNA polymerase I transcription; transcription initiation from RNA polymerase I promoter
Research Articles on TWISTNB
Similar Products
Product Notes
The TWISTNB twistnb (Catalog #AAA1278943) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcag gttgctcaga ggcgccgcgg ccagcggcgg cttctgatgg gtctctggta gggcaggctg gcgtcctgcc ttgcctagag ttgccgactt atgccgctgc ttgtgcgctg gtgaacagtc gctactcatg cctggtggcc gggccgcacc aaaggcacat cgcgctgtcg ccccgctacc ttaacaggaa acgcaccggc attcgagaac agcttgatgc ggagctcctt cgctattctg agagcctttt aggtgtccct attgcatatg ataacatcaa agttgtggga gagcttggag atatttatga tgatcaagga cacattcatc ttaacattga agccgatttt gttattttct gccctgaacc agggcagaag cttatgggta tagttaataa agtgtcttct agccacattg gctgtttagt acatgggtgt ttcaatgcct ccattcctaa acctgagcag ttgtcagctg agcagtggca aaccatggag ataaacatgg gtgatgaact agaatttgaa gtatttcgtt tagactcaga tgctgctgga gtattctgca ttcggggaaa actaaatatc acaagtttac aattcaagcg ctctgaagtt tctgaagaag ttacagaaaa tggcactgag gaagctgcta aaaaacctaa aaagaagaaa aagaagaaag acccagagac atatgaagtg gacagtggta ccacaaagct agcagatgat gcagatgaca ctccaatgga agagtcagcc ctgcagaata ctaataatgc gaatggcatc tgggaggagg agccaaagaa aaagaagaag aagaaaaagc accaggaagt tcaggaccag gaccctgttt tccaaggcag tgactccagt ggttaccaaa gtgaccataa aaagaaaaaa aagaaaagaa aacacagtga agaggccgaa tttaccccac ctttgaaatg ctcaccaaaa agaaaaggga aaagtaattt tctttag. It is sometimes possible for the material contained within the vial of "TWISTNB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
