RGL2 cdna clone
RGL2 cDNA Clone
Gene Names
RGL2; KE1.5; RAB2L; HKE1.5
Synonyms
RGL2; RGL2 cDNA Clone; RGL2 cdna clone
Sequence
atgctcccgcggcccctgcggctgcttttggacacgagcccccccgggggagtcgtactgagcagcttccgaagccgggaccccgaagagggtgggggcccaggtggcctggtcgtgggcggggggcaggaggaagaggaggaggaagaagaagaggcccctgtgtccgtctgggatgaggaggaggatggtgccgtgtttaccgtcacaagccgccaatatcgacctcttgatcccttggtccctatgcctcccccacgttcctcccgacggctccgagctggcactctggaggccctggtcagacacctactggatacccggacatcagggactgatgtgagcttcatgtcagccttcctggctacccaccgggccttcacctccacgcctgccttgctagggcttatggctgacaggctggaagcccttgaatctcatcctaccgacgaactagagaggacaacagaggtagccatctctgtactgtcaacctggctggcctctcaccctgaggattttggctctgaggccaagggtcagcttgaccggcttgagagcttcttacttcagacagggtatgcagcagggaagggtgttggggggggcagcgctgacctcatccgcaatctccggtcccgggtggacccccaggcccccgaccttcctaagcccctggccctccccggcgatccccctgctgaccccacggatgtcctggtgttcctcgctgaccacttggccgaacagctgaccctgctagatgcggaactttttctcaatttgatcccctctcagtgcctgggaggcctgtggggtcacagagaccggccaggacattctcacctctgcccatctgtccgagctactgtcacacagtttaacaaggtggcaggggcagtggttagttctgtcctgggggctacttccactggagagggacctggggaggtgaccatacggccactccgtcccccacagagggcccggctcctggagaagtggatccgcgtggcagaggagtgccggctgctccgaaacttctcttcagtttatgccgtggtgtcagccctgcagtccagccccatccacaggcttcgggcagcctggggggaagcaaccagggacagcctcagagtcttttccagcctctgccagattttctccgaggaggataattattcccagagtcgggagctgctcgtgcaggaggtgaagctgcagtctcctctggagccacactccaagaaggccccgaggtctggctcccggggtgggggtgtggtcccataccttggcaccttcctgaaggaccttgtgatgctggatgcagcctccaaggatgagttggagaatggatacatcaattttgacaagcggaggaaggagtttgcagtcctttctgagttgcgacggctccagaatgaatgtcgtggctataacctccaacctgaccatgatatccagaggtggctacaggggctccggccactgacagaggctcagagccatcgtgtatcctgtgaggtggagccacctggttccagtgaccctcctgccccacgggtgcttcggccaacattggtcatctcgcagtggacagaggttttgggctctgttggggtccctaccccgcttgtgtcctgtgaccggcccagtactgggggagatgaggcgcctacaactcctgctcctctgctgactcggctggcccagcacatgaagtggccatctgtctcgtcactagactctgccttggaaagcagtccatccctgcacagtccagctgaccccagccacctctccccaccagcctcctcccctaggccttctcgaggtcaccgccgctcagcctcctgtggctccccgctgagtgggggtgcagaagaggcctccggggggactggatatgggggagagggatctgggccaggggcctctgattgccgtatcatccgagtccagatggagttgggggaagatggcagtgtctataagagcattttggtgacaagccaggacaaggctccaagtgtcatcagtcgtgtccttaagaaaaacaatcgtgactctgcagtggcttcagagtatgagctggtacagctgctaccaggggagcgagagctgactatcccagcctcggctaatgtattctacgccatggatggagcttcacacgatttcctcctgcggcagcggcgaaggtcctctactgctacacctggcgtcaccagtggcccgtctgcctcaggaactcctccgagtgagggaggagggggctcctttcccaggatcaaggccacagggaggaagattgcacgggcactgttctga
Sequence Length
2334
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,224 Da
NCBI Official Full Name
Homo sapiens ral guanine nucleotide dissociation stimulator-like 2, mRNA
NCBI Official Synonym Full Names
ral guanine nucleotide dissociation stimulator like 2
NCBI Official Symbol
RGL2
NCBI Official Synonym Symbols
KE1.5; RAB2L; HKE1.5
NCBI Protein Information
ral guanine nucleotide dissociation stimulator-like 2
UniProt Protein Name
Ral guanine nucleotide dissociation stimulator-like 2
Protein Family
UniProt Gene Name
RGL2
UniProt Synonym Gene Names
RAB2L; RalGDS-like 2
UniProt Entry Name
RGL2_HUMAN
Uniprot Description
RGL2: Probable guanine nucleotide exchange factor. Putative effector of Ras and/or Rap. Associates with the GTP-bound form of Rap 1A and H-Ras in vitro.
Protein type: GEFs, Ras; GEFs
Chromosomal Location of Human Ortholog: 6p21.3
Molecular Function: protein binding
Research Articles on RGL2
Similar Products
Product Notes
The RGL2 rgl2 (Catalog #AAA1278895) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcccgc ggcccctgcg gctgcttttg gacacgagcc cccccggggg agtcgtactg agcagcttcc gaagccggga ccccgaagag ggtgggggcc caggtggcct ggtcgtgggc ggggggcagg aggaagagga ggaggaagaa gaagaggccc ctgtgtccgt ctgggatgag gaggaggatg gtgccgtgtt taccgtcaca agccgccaat atcgacctct tgatcccttg gtccctatgc ctcccccacg ttcctcccga cggctccgag ctggcactct ggaggccctg gtcagacacc tactggatac ccggacatca gggactgatg tgagcttcat gtcagccttc ctggctaccc accgggcctt cacctccacg cctgccttgc tagggcttat ggctgacagg ctggaagccc ttgaatctca tcctaccgac gaactagaga ggacaacaga ggtagccatc tctgtactgt caacctggct ggcctctcac cctgaggatt ttggctctga ggccaagggt cagcttgacc ggcttgagag cttcttactt cagacagggt atgcagcagg gaagggtgtt ggggggggca gcgctgacct catccgcaat ctccggtccc gggtggaccc ccaggccccc gaccttccta agcccctggc cctccccggc gatccccctg ctgaccccac ggatgtcctg gtgttcctcg ctgaccactt ggccgaacag ctgaccctgc tagatgcgga actttttctc aatttgatcc cctctcagtg cctgggaggc ctgtggggtc acagagaccg gccaggacat tctcacctct gcccatctgt ccgagctact gtcacacagt ttaacaaggt ggcaggggca gtggttagtt ctgtcctggg ggctacttcc actggagagg gacctgggga ggtgaccata cggccactcc gtcccccaca gagggcccgg ctcctggaga agtggatccg cgtggcagag gagtgccggc tgctccgaaa cttctcttca gtttatgccg tggtgtcagc cctgcagtcc agccccatcc acaggcttcg ggcagcctgg ggggaagcaa ccagggacag cctcagagtc ttttccagcc tctgccagat tttctccgag gaggataatt attcccagag tcgggagctg ctcgtgcagg aggtgaagct gcagtctcct ctggagccac actccaagaa ggccccgagg tctggctccc ggggtggggg tgtggtccca taccttggca ccttcctgaa ggaccttgtg atgctggatg cagcctccaa ggatgagttg gagaatggat acatcaattt tgacaagcgg aggaaggagt ttgcagtcct ttctgagttg cgacggctcc agaatgaatg tcgtggctat aacctccaac ctgaccatga tatccagagg tggctacagg ggctccggcc actgacagag gctcagagcc atcgtgtatc ctgtgaggtg gagccacctg gttccagtga ccctcctgcc ccacgggtgc ttcggccaac attggtcatc tcgcagtgga cagaggtttt gggctctgtt ggggtcccta ccccgcttgt gtcctgtgac cggcccagta ctgggggaga tgaggcgcct acaactcctg ctcctctgct gactcggctg gcccagcaca tgaagtggcc atctgtctcg tcactagact ctgccttgga aagcagtcca tccctgcaca gtccagctga ccccagccac ctctccccac cagcctcctc ccctaggcct tctcgaggtc accgccgctc agcctcctgt ggctccccgc tgagtggggg tgcagaagag gcctccgggg ggactggata tgggggagag ggatctgggc caggggcctc tgattgccgt atcatccgag tccagatgga gttgggggaa gatggcagtg tctataagag cattttggtg acaagccagg acaaggctcc aagtgtcatc agtcgtgtcc ttaagaaaaa caatcgtgac tctgcagtgg cttcagagta tgagctggta cagctgctac caggggagcg agagctgact atcccagcct cggctaatgt attctacgcc atggatggag cttcacacga tttcctcctg cggcagcggc gaaggtcctc tactgctaca cctggcgtca ccagtggccc gtctgcctca ggaactcctc cgagtgaggg aggagggggc tcctttccca ggatcaaggc cacagggagg aagattgcac gggcactgtt ctga. It is sometimes possible for the material contained within the vial of "RGL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
