HNRNPUL1 cdna clone

HNRNPUL1 cDNA Clone

Gene Names

HNRNPUL1; E1BAP5; E1B-AP5; HNRPUL1

Synonyms

HNRNPUL1; HNRNPUL1 cDNA Clone; HNRNPUL1 cdna clone

Ordering
Cat. Num. AAA1278854 For Research Use Only!

Sequence

atggatgtgcgccgtctgaaggtgaacgaacttcgcgaggagctgcagcgccgcggcctggacactcgaggcctcaaggccgagcttgctgagcggctgcaggcggcgttggaggccgaggagcctgacgacgagcgggagctcgacgccgacgacgaaccggggcgacccgggcacatcaacgaggaggtcgagaccgaggggggctccgagctggaggggaccgcgcagccaccgccgcccgggctgcagccgcacgcggagcccggcggctactcggggccggacggacattatgccatggacaatattaccaggcagaaccaattctacgatacccaagtcatcaaacaagaaaacgagtcaggctacgagaggagaccactggaaatggagcagcagcaggcctatcgtccagaaatgaagacagagatgaagcaaggagcacccaccagcttcctcccgcctgaagcttctcaactcaagccagacaggcagcaattccagagtcgaaagaggccttatgaagaaaaccggggacgggggtactttgagcaccgagaggataggaggggccgctctcctcagcctcctgctgaagaggatgaagatgactttgatgatacccttgttgctattgacacctataactgcgacctccacttcaaggtggcccgagatcggagtagtggctatccgctcacaattgagggctttgcatacctgtggtcaggagcccgtgccagctatggggtcagaaggggccgtgtatgcttcgagatgaagatcaatgaggaaatctccgtgaagcaccttccgtctacagagcctgacccccacgtggtccgtatcggctggtccctggactcctgcagcacccagctaggcgaagagcctttctcctatggctatggaggcactgggaagaagtccaccaatagccggtttgaaaactacggagacaagtttgcagagaacgatgtgattggctgctttgcggattttgaatgtggaaatgacgtggaactgtcttttaccaagaatggaaagtggatgggcattgctttccgaatccagaaggaagccttggggggtcaggccctctatcctcatgtcctggtgaagaattgcgcagtggagttcaacttcggacagagagcagagccctactgttctgtcctcccggggtttaccttcatccagcaccttccccttagtgagcgtatccggggcaccgttggaccaaagagcaaggcagaatgtgagattctgatgatggtgggcctgcctgctgctggcaagaccacatgggccatcaaacatgcagcctccaacccttccaagaagtacaacatcctgggtaccaatgccatcatggataagatgcgggtgatgggcctacgccggcagcggaactatgctggccgctgggatgtcctgatccagcaggccacccagtgcctcaaccgcctcatccagattgctgcccgcaagaaacgcaactatatcctagatcagacaaatgtttatgggtcagcccagagacgaaaaatgagaccatttgaaggcttccagcgcaaagctattgtaatttgtcccactgacgaggacctaaaagaccgaacaataaagcgaaccgacgaggaagggaaggatgtcccagatcatgcggtcttagaaatgaaagccaacttcacgttgccagatgttggggacttcctggatgaggttctgttcattgagctgcagcgggaggaagcggacaagctagtgaggcagtacaacgaggaaggccgcaaggctgggccaccccctgaaaagcgctttgacaaccgaggtggtggtggcttccggggccgcgggggtggtggtggcttccagcgctatgaaaaccgaggaccccctggaggcaaccgtggcggcttccagaaccgagggggaggcagcggtggaggaggcaactaccgaggaggtttcaaccgcagcggaggtggtggctatagccagaaccgctggggtaacaacaaccgggataacaacaactccaacaacagaggcagctacaaccgggctccccagcaacagccgccgccacagcagcctccgccaccacagccaccaccccagcagccaccgccaccacccagctacagccctgctcggaaccccccaggggccagcacctacaataagaacagcaacatccctggctcaagcgccaataccagcacccccaccgtcagcagctacagccctccacagacctaccctcagcccagctataaccagtatcagcagtatgcccagcagtggaaccagtactatcagaaccagggccagtggccgccatactacgggaactacgactacgggagctactccgggaacacacagggtggcacaagtacacagtag

Sequence Length

2415

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

33872570

NCBI GeneID

11100

Molecular Weight

42,189 Da

NCBI Official Full Name

Homo sapiens heterogeneous nuclear ribonucleoprotein U-like 1, mRNA

NCBI Official Synonym Full Names

heterogeneous nuclear ribonucleoprotein U like 1

NCBI Official Symbol

HNRNPUL1

NCBI Official Synonym Symbols

E1BAP5; E1B-AP5; HNRPUL1

NCBI Protein Information

heterogeneous nuclear ribonucleoprotein U-like protein 1

UniProt Protein Name

Heterogeneous nuclear ribonucleoprotein U-like protein 1

Protein Family

Heterogeneous nuclear ribonucleoprotein U-like protein

UniProt Gene Name

HNRNPUL1

UniProt Synonym Gene Names

E1BAP5; HNRPUL1; E1B-AP5

UniProt Entry Name

HNRL1_HUMAN

NCBI Description

This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus early-1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by early-1B-55kDa in adenovirus-infected cells. [provided by RefSeq, Mar 2016]

Uniprot Description

E1B-AP5: a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. Binds specifically to adenovirus E1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by E1B-55kDa in adenovirus-infected cells. Four alternatively spliced isoforms have been described.

Protein type: RNA-binding; RNA splicing

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: enzyme binding; protein binding; RNA binding

Biological Process: nuclear mRNA splicing, via spliceosome; RNA processing

Research Articles on HNRNPUL1

1. we define the arginines within the RGG/RG motifs as the site of methylation by PRMT1 both in vitro and in vivo. The arginines within the human hnRNPUL1 RGG/RG motifs were substituted with lysines to generate hnRNPUL1(RK).

Similar Products

HNRNPUL1 Antibody

Host: n/a

Reactivity: n/a

Apps: n/a

HNRNPUL1 Antibody

Host: Rabbit

Reactivity: Human, Mouse, Rat

Apps: ELISA, Western Blot, Immunohistochemistry, Immunofluorescence, Flow Cytometry, Functional Assay, Immunoprecipitation

Product Notes

The HNRNPUL1 hnrnpul1 (Catalog #AAA1278854) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgtgc gccgtctgaa ggtgaacgaa cttcgcgagg agctgcagcg ccgcggcctg gacactcgag gcctcaaggc cgagcttgct gagcggctgc aggcggcgtt ggaggccgag gagcctgacg acgagcggga gctcgacgcc gacgacgaac cggggcgacc cgggcacatc aacgaggagg tcgagaccga ggggggctcc gagctggagg ggaccgcgca gccaccgccg cccgggctgc agccgcacgc ggagcccggc ggctactcgg ggccggacgg acattatgcc atggacaata ttaccaggca gaaccaattc tacgataccc aagtcatcaa acaagaaaac gagtcaggct acgagaggag accactggaa atggagcagc agcaggccta tcgtccagaa atgaagacag agatgaagca aggagcaccc accagcttcc tcccgcctga agcttctcaa ctcaagccag acaggcagca attccagagt cgaaagaggc cttatgaaga aaaccgggga cgggggtact ttgagcaccg agaggatagg aggggccgct ctcctcagcc tcctgctgaa gaggatgaag atgactttga tgataccctt gttgctattg acacctataa ctgcgacctc cacttcaagg tggcccgaga tcggagtagt ggctatccgc tcacaattga gggctttgca tacctgtggt caggagcccg tgccagctat ggggtcagaa ggggccgtgt atgcttcgag atgaagatca atgaggaaat ctccgtgaag caccttccgt ctacagagcc tgacccccac gtggtccgta tcggctggtc cctggactcc tgcagcaccc agctaggcga agagcctttc tcctatggct atggaggcac tgggaagaag tccaccaata gccggtttga aaactacgga gacaagtttg cagagaacga tgtgattggc tgctttgcgg attttgaatg tggaaatgac gtggaactgt cttttaccaa gaatggaaag tggatgggca ttgctttccg aatccagaag gaagccttgg ggggtcaggc cctctatcct catgtcctgg tgaagaattg cgcagtggag ttcaacttcg gacagagagc agagccctac tgttctgtcc tcccggggtt taccttcatc cagcaccttc cccttagtga gcgtatccgg ggcaccgttg gaccaaagag caaggcagaa tgtgagattc tgatgatggt gggcctgcct gctgctggca agaccacatg ggccatcaaa catgcagcct ccaacccttc caagaagtac aacatcctgg gtaccaatgc catcatggat aagatgcggg tgatgggcct acgccggcag cggaactatg ctggccgctg ggatgtcctg atccagcagg ccacccagtg cctcaaccgc ctcatccaga ttgctgcccg caagaaacgc aactatatcc tagatcagac aaatgtttat gggtcagccc agagacgaaa aatgagacca tttgaaggct tccagcgcaa agctattgta atttgtccca ctgacgagga cctaaaagac cgaacaataa agcgaaccga cgaggaaggg aaggatgtcc cagatcatgc ggtcttagaa atgaaagcca acttcacgtt gccagatgtt ggggacttcc tggatgaggt tctgttcatt gagctgcagc gggaggaagc ggacaagcta gtgaggcagt acaacgagga aggccgcaag gctgggccac cccctgaaaa gcgctttgac aaccgaggtg gtggtggctt ccggggccgc gggggtggtg gtggcttcca gcgctatgaa aaccgaggac cccctggagg caaccgtggc ggcttccaga accgaggggg aggcagcggt ggaggaggca actaccgagg aggtttcaac cgcagcggag gtggtggcta tagccagaac cgctggggta acaacaaccg ggataacaac aactccaaca acagaggcag ctacaaccgg gctccccagc aacagccgcc gccacagcag cctccgccac cacagccacc accccagcag ccaccgccac cacccagcta cagccctgct cggaaccccc caggggccag cacctacaat aagaacagca acatccctgg ctcaagcgcc aataccagca cccccaccgt cagcagctac agccctccac agacctaccc tcagcccagc tataaccagt atcagcagta tgcccagcag tggaaccagt actatcagaa ccagggccag tggccgccat actacgggaa ctacgactac gggagctact ccgggaacac acagggtggc acaagtacac agtag. It is sometimes possible for the material contained within the vial of "HNRNPUL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

HNRNPUL1 cdna clone