Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBL7 cdna clone

UBL7 cDNA Clone

Gene Names
UBL7; TCBA1; BMSC-UbP
Synonyms
UBL7; UBL7 cDNA Clone; UBL7 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctctctcagactggcacctggcggtgaagctggctgaccagccacttactccaaagtctattcttcggttgccagagacagaactgggagaatactcgctagggggctatagtatttcatttctgaagcagcttattgctggcaaactccaggagtctgttccagaccctgagctgattgatctgatctactgtggtcggaagctaaaagatgaccagacacttgacttctatggcattcaacctgggtccactgtccatgttctgcgaaagtcctggcctgaacctgatcagaaaccggaacctgtggacaaagtggctgccatgagagagttccgggtgttgcacactgccctgcacagcagctcctcttacagggaggcggtctttaagatgctcagcaataaggagtctctggatcagatcattgtggccaccccaggcctcagcagtgaccctattgctcttggggttctccaggacaaggacctcttctctgtcttcgctgatcccaatatgcttgatacgttggtgcctgctcacccagccctcgtcaatgccattgtcctggttctgcactccgtagcaggcagtgccccaatgcctgggactgactcctcttcccggagcatgccctccagctcataccgggatatgccaggtggcttcctgtttgaagggctctcagatgatgaggatgactttcacccaaacaccaggtccacaccctctagcagtactcccagctcccgcccagcctccctggggtacagtggagctgctgggccccggcccatcacccagagtgagctggccaccgccttggccctggccagcactccggagagcagctctcacacaccgactcctggcacccagggtcattcctcagggacctcaccaatgtcctctggtgtccagtcagggacgcccatcaccaatgatctcttcagccaagccctacagcatgcccttcaggcctctgggcagcccagccttcagagccagtggcagccccagctgcagcagctacgtgacatgggcatccaggacgatgagctgagcctgcgggccctgcaggccaccggtggggacatccaagcagccctggagctcatctttgctggaggagccccatga
Sequence Length
1143
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,510 Da
NCBI Official Full Name
Homo sapiens ubiquitin-like 7 (bone marrow stromal cell-derived), mRNA
NCBI Official Synonym Full Names
ubiquitin like 7
NCBI Official Symbol
UBL7
NCBI Official Synonym Symbols
TCBA1; BMSC-UbP
NCBI Protein Information
ubiquitin-like protein 7
UniProt Protein Name
Ubiquitin-like protein 7
Protein Family
UniProt Gene Name
UBL7
UniProt Synonym Gene Names
BMSCUBP; BMSC-UbP
UniProt Entry Name
UBL7_HUMAN

Uniprot Description

UBL7: Down-regulated by PMA in bone marrow stroma cells. Binds ubiquitin.

Protein type: Ubiquitin-like modifier

Chromosomal Location of Human Ortholog: 15q24.1

Molecular Function: protein binding

Research Articles on UBL7

Similar Products

Product Notes

The UBL7 ubl7 (Catalog #AAA1278787) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctctct cagactggca cctggcggtg aagctggctg accagccact tactccaaag tctattcttc ggttgccaga gacagaactg ggagaatact cgctaggggg ctatagtatt tcatttctga agcagcttat tgctggcaaa ctccaggagt ctgttccaga ccctgagctg attgatctga tctactgtgg tcggaagcta aaagatgacc agacacttga cttctatggc attcaacctg ggtccactgt ccatgttctg cgaaagtcct ggcctgaacc tgatcagaaa ccggaacctg tggacaaagt ggctgccatg agagagttcc gggtgttgca cactgccctg cacagcagct cctcttacag ggaggcggtc tttaagatgc tcagcaataa ggagtctctg gatcagatca ttgtggccac cccaggcctc agcagtgacc ctattgctct tggggttctc caggacaagg acctcttctc tgtcttcgct gatcccaata tgcttgatac gttggtgcct gctcacccag ccctcgtcaa tgccattgtc ctggttctgc actccgtagc aggcagtgcc ccaatgcctg ggactgactc ctcttcccgg agcatgccct ccagctcata ccgggatatg ccaggtggct tcctgtttga agggctctca gatgatgagg atgactttca cccaaacacc aggtccacac cctctagcag tactcccagc tcccgcccag cctccctggg gtacagtgga gctgctgggc cccggcccat cacccagagt gagctggcca ccgccttggc cctggccagc actccggaga gcagctctca cacaccgact cctggcaccc agggtcattc ctcagggacc tcaccaatgt cctctggtgt ccagtcaggg acgcccatca ccaatgatct cttcagccaa gccctacagc atgcccttca ggcctctggg cagcccagcc ttcagagcca gtggcagccc cagctgcagc agctacgtga catgggcatc caggacgatg agctgagcct gcgggccctg caggccaccg gtggggacat ccaagcagcc ctggagctca tctttgctgg aggagcccca tga. It is sometimes possible for the material contained within the vial of "UBL7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.