Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SETDB1 cdna clone

SETDB1 cDNA Clone

Gene Names
SETDB1; ESET; KG1T; KMT1E; TDRD21; H3-K9-HMTase4
Synonyms
SETDB1; SETDB1 cDNA Clone; SETDB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcttcccttcctgggtgcattggtttggatgcagcaacagctacagtggagtctgaagagattgcagagctgcaacaggcagtggttgaggaactgggtatctctatggaggaacttcggcatttcatcgatgaggaactggagaagatggattgtgtacagcaacgcaagaagcagctagcagagttagagacatgggtaatacagaaagaatctgaggtggctcacgttgaccaactctttgatgatgcatccagggcagtgactaattgtgagtctttggtgaaggacttctactccaagctgggactacaataccgggacagtagctctgaggacgaatcttcccggcctacagaaataattgagattcctgatgaagatgatgatgtcctcagtattgattcaggtgatgctgggagcagaactccaaaagaccagaagctccgtgaagctatggctgccttaagaaagtcagctcaagatgttcagaagttcatggatgctgtcaacaagaagagcagttcccaggatctgcataaaggaaccttgagtcagatgtctggagaactaagcaaagatggtgacctgatagtcagcatgcgaattctgggcaagaagagaactaagacttggcacaaaggcacccttattgccatccagacagttgggccagggaagaaatacaaggtgaaatttgacaacaaaggaaagagtctactgtcggggaaccatattgcctatgattaccaccctcctgctgacaagctgtatgtgggcagtcgggtggtcgccaaatacaaagatgggaatcaggtctggctctatgctggcattgtagctgagacaccaaacgtcaaaaacaagctcaggtttctcattttctttgatgatggctatgcttcctatgtcacacagtcggaactgtatcccatttgccggccactgaaaaagacttgggaggacatagaagacatctcctgccgtgacttcatagaggagtatgtcactgcctaccccaaccgccccatggtactgctcaagagtggccagcttatcaagactgagtgggaaggcacgtggtggaagtcccgagttgaggaggtggatggcagcctagtcaggatcctcttcctggtactgttcttctctacaattttggaggcagaggttggtggggggggaacttaa
Sequence Length
1194
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
143,001 Da
NCBI Official Full Name
Homo sapiens SET domain, bifurcated 1, mRNA
NCBI Official Synonym Full Names
SET domain bifurcated 1
NCBI Official Symbol
SETDB1
NCBI Official Synonym Symbols
ESET; KG1T; KMT1E; TDRD21; H3-K9-HMTase4
NCBI Protein Information
histone-lysine N-methyltransferase SETDB1
UniProt Protein Name
Histone-lysine N-methyltransferase SETDB1
UniProt Gene Name
SETDB1
UniProt Synonym Gene Names
KIAA0067; KMT1E; ESET; H3-K9-HMTase 4
UniProt Entry Name
SETB1_HUMAN

NCBI Description

This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]

Uniprot Description

SETDB1: a protein lysine methyltransferase that specifically trimethylates K9 of histone H3 (H3K9me3), a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Unlike SUV39H H3K9 methyltransferase, which functions mainly in heterochromatin regions such as pericentric heterochromatin, SETDB1 functions mainly in euchromatic regions, playing a central role in the silencing of euchromatic genes. H3K9me3 is coordinated with DNA methylation. Interacts with a variety of proteins, including transcription factors (ERG), histone deacetylases (HDAC1/2), DNA methyltransferases (DNMT3A/B) and transcriptional co-repressors (mSin3A/B, MBD1, KAP-1, the ATFa-associated modulator mAM). Its activity is dependent on MBD1 and is heritably maintained through DNA replication by being recruited by CAF-1. Contains Tudor and methyl-CpG-binding domains, which may coordinate binding to methylated histones and methylated DNA, respectively. Is targeted to histone H3 by TIF1B, a factor recruited by KRAB zinc-finger proteins. Recruited by DNMT3A to silenced promoters in cancer cells. May play a role in the pathogenesis of Huntington's disease, since levels of SETDB1 and H3K9me3 are both increased in diseased brains. Belongs to the histone-lysine methyltransferase family. Suvar3-9 subfamily. Three isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - lysine degradation; Methyltransferase, protein lysine; Methyltransferase; EC 2.1.1.43

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: cytoplasm; intracellular membrane-bound organelle; nucleoplasm; nucleus; plasma membrane

Molecular Function: chromatin binding; protein binding

Biological Process: Ras protein signal transduction

Research Articles on SETDB1

Similar Products

Product Notes

The SETDB1 setdb1 (Catalog #AAA1278729) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcttccc ttcctgggtg cattggtttg gatgcagcaa cagctacagt ggagtctgaa gagattgcag agctgcaaca ggcagtggtt gaggaactgg gtatctctat ggaggaactt cggcatttca tcgatgagga actggagaag atggattgtg tacagcaacg caagaagcag ctagcagagt tagagacatg ggtaatacag aaagaatctg aggtggctca cgttgaccaa ctctttgatg atgcatccag ggcagtgact aattgtgagt ctttggtgaa ggacttctac tccaagctgg gactacaata ccgggacagt agctctgagg acgaatcttc ccggcctaca gaaataattg agattcctga tgaagatgat gatgtcctca gtattgattc aggtgatgct gggagcagaa ctccaaaaga ccagaagctc cgtgaagcta tggctgcctt aagaaagtca gctcaagatg ttcagaagtt catggatgct gtcaacaaga agagcagttc ccaggatctg cataaaggaa ccttgagtca gatgtctgga gaactaagca aagatggtga cctgatagtc agcatgcgaa ttctgggcaa gaagagaact aagacttggc acaaaggcac ccttattgcc atccagacag ttgggccagg gaagaaatac aaggtgaaat ttgacaacaa aggaaagagt ctactgtcgg ggaaccatat tgcctatgat taccaccctc ctgctgacaa gctgtatgtg ggcagtcggg tggtcgccaa atacaaagat gggaatcagg tctggctcta tgctggcatt gtagctgaga caccaaacgt caaaaacaag ctcaggtttc tcattttctt tgatgatggc tatgcttcct atgtcacaca gtcggaactg tatcccattt gccggccact gaaaaagact tgggaggaca tagaagacat ctcctgccgt gacttcatag aggagtatgt cactgcctac cccaaccgcc ccatggtact gctcaagagt ggccagctta tcaagactga gtgggaaggc acgtggtgga agtcccgagt tgaggaggtg gatggcagcc tagtcaggat cctcttcctg gtactgttct tctctacaat tttggaggca gaggttggtg gggggggaac ttaa. It is sometimes possible for the material contained within the vial of "SETDB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.