LPPR2 cdna clone
LPPR2 cDNA Clone
Gene Names
PLPPR2; PRG4; LPPR2
Synonyms
LPPR2; LPPR2 cDNA Clone; LPPR2 cdna clone
Sequence
atggcgggagggagaccgcatctgaagaggagtttctccatcatcccctgctttgtcttcgtggagtcggtgctgctgggcattgtgatcctgcttgcttaccgcctggagttcacggacaccttccctgtgcacacccagggattcttctgctatgacagtacctacgccaagccctacccagggcctgaggctgccagccgagtgcctcctgctcttgtctacgcactggtcactgccgggcccaccctcacgatcctgctgggagagctggcgcgtgcctttttccctgcaccaccttcagccgtcccagtcatcggggagagcaccatcgtgtctggggcctgctgccgcttcagccccccagtgcggaggctggtccgcttcctgggggtctactccttcggcctcttcaccacgaccatcttcgccaacgcggggcaggtggtgaccggcaatcccacgccacacttcctgtccgtgtgccgccccaactacacggccctgggctgcctgccaccttctccggatcggccaggtcccgaccgctttgtcactgaccagggtgcctgcgctggcagtcccagcctcgtggccgccgcgcgccgcgccttcccctgcaaggatgcggccctctgcgcctacgcggtcacctacacagcgatgtacgtgactctcgtgttccgcgtgaagggctcccgcctggtcaaaccctcgctctgcctggccttgctgtgcccggccttcctggtgggcgtggtccgcgtggccgagtaccgaaaccactggtcggacgtgctggctggcttcctgacaggggcggccatcgccacctttttggtcacctgcgttgtgcataactttcagagccggccaccctctggccgaaggctctctccctgggaggacctgggccaagcccccaccatggatagccccctcgaaaagaacccgaggtctgcaggccgcattcgacaccggcacggctcaccccatccaagtcgcagaactgcgcccgccgtggccacctga
Sequence Length
1032
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,576 Da
NCBI Official Full Name
Homo sapiens lipid phosphate phosphatase-related protein type 2, mRNA
NCBI Official Synonym Full Names
phospholipid phosphatase related 2
NCBI Official Symbol
PLPPR2
NCBI Official Synonym Symbols
PRG4; LPPR2
NCBI Protein Information
phospholipid phosphatase-related protein type 2
UniProt Protein Name
Phospholipid phosphatase-related protein type 2
UniProt Gene Name
PLPPR2
UniProt Synonym Gene Names
PRG-4
UniProt Entry Name
PLPR2_HUMAN
Uniprot Description
LPPR2: Belongs to the PA-phosphatase related phosphoesterase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass; EC 3.1.3.4; Phosphatase (non-protein)
Chromosomal Location of Human Ortholog: 19p13.2
Cellular Component: integral to plasma membrane
Molecular Function: lipid phosphatase activity
Biological Process: phospholipid dephosphorylation; phospholipid metabolic process; signal transduction
Similar Products
Product Notes
The LPPR2 plppr2 (Catalog #AAA1278698) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggag ggagaccgca tctgaagagg agtttctcca tcatcccctg ctttgtcttc gtggagtcgg tgctgctggg cattgtgatc ctgcttgctt accgcctgga gttcacggac accttccctg tgcacaccca gggattcttc tgctatgaca gtacctacgc caagccctac ccagggcctg aggctgccag ccgagtgcct cctgctcttg tctacgcact ggtcactgcc gggcccaccc tcacgatcct gctgggagag ctggcgcgtg cctttttccc tgcaccacct tcagccgtcc cagtcatcgg ggagagcacc atcgtgtctg gggcctgctg ccgcttcagc cccccagtgc ggaggctggt ccgcttcctg ggggtctact ccttcggcct cttcaccacg accatcttcg ccaacgcggg gcaggtggtg accggcaatc ccacgccaca cttcctgtcc gtgtgccgcc ccaactacac ggccctgggc tgcctgccac cttctccgga tcggccaggt cccgaccgct ttgtcactga ccagggtgcc tgcgctggca gtcccagcct cgtggccgcc gcgcgccgcg ccttcccctg caaggatgcg gccctctgcg cctacgcggt cacctacaca gcgatgtacg tgactctcgt gttccgcgtg aagggctccc gcctggtcaa accctcgctc tgcctggcct tgctgtgccc ggccttcctg gtgggcgtgg tccgcgtggc cgagtaccga aaccactggt cggacgtgct ggctggcttc ctgacagggg cggccatcgc cacctttttg gtcacctgcg ttgtgcataa ctttcagagc cggccaccct ctggccgaag gctctctccc tgggaggacc tgggccaagc ccccaccatg gatagccccc tcgaaaagaa cccgaggtct gcaggccgca ttcgacaccg gcacggctca ccccatccaa gtcgcagaac tgcgcccgcc gtggccacct ga. It is sometimes possible for the material contained within the vial of "LPPR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
