RAB3IL1 cdna clone
RAB3IL1 cDNA Clone
Gene Names
RAB3IL1; GRAB
Synonyms
RAB3IL1; RAB3IL1 cDNA Clone; RAB3IL1 cdna clone
Sequence
atgtggagcggcccaccccagccagaccagggcctcccgccgccccttgcagctgtcccggtcccctggaagagcacggacccctgccaaggccacagggagtccccaggagccctggtggagacctctgcaggggaggaggcccaaggccaggagggccccgcagccgcccagctggacgtgttgcgcctgcgcagctcttccatggagatccgagagaagggctccgagttcctgaaggaggagctgcacagagcgcagaaggagctgaagctaaaggacgaggaatgtgagcggctgtccaaggtgcgggagcagctagaacaggagctggaagagctgacggccagcctgtttgaggaagctcacaagatggttcgagaagccaacatgaagcaggcggcatcagaaaagcagctgaaggaggctcggggcaagatcgacatgctgcaggcagaggtgacagccttgaagacactggtcatcacgtccacaccagcctctcccaaccgcgagcttcacccccagctgctgagccccaccaaggccgggccccgaaagggccactctcgccacaagagcaccagcagcaccctctgccccgccgtgtgtcccgctgcgggacacaccctcaccccagacagagagggcaaggaggtggacacaatcctgtttgcagagttccaggcctggagggaatcccccaccctggacaagacctgccccttcctggaaagggtgtaccgagaggacgtgggcccctgcctggacttcacaatgcaggagctctcggtgctggtacgggccgccgtggaggacaacacgctcaccattgagccggtggcttcgcagacgctgcccacagtgaaggtggccgaggttgactgtagcagcaccaacacatgtgccctgagcgggctgacccgcacctgccgccaccgaatccggctcggggactccaaaagccattactacatctcgccatcttcccgggccaggatcaccgcagtgtgcaacttcttcacctacatccgctacatccagcaaggcctggtgcggcaggacgcagagcccatgttctgggagatcatgaggttgcggaaggagatgtcactggccaagctcggcttcttcccccaggaggcttag
Sequence Length
1149
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,791 Da
NCBI Official Full Name
Homo sapiens RAB3A interacting protein (rabin3)-like 1, mRNA
NCBI Official Synonym Full Names
RAB3A interacting protein like 1
NCBI Official Symbol
RAB3IL1
NCBI Official Synonym Symbols
GRAB
NCBI Protein Information
guanine nucleotide exchange factor for Rab-3A
UniProt Protein Name
Guanine nucleotide exchange factor for Rab-3A
Protein Family
UniProt Gene Name
RAB3IL1
UniProt Synonym Gene Names
Rab3A-interacting-like protein 1
UniProt Entry Name
R3GEF_HUMAN
NCBI Description
This gene encodes a guanine nucleotide exchange factor for the ras-related protein Rab3A. The encoded protein binds Rab3a and the inositol hexakisphosphate kinase InsP6K1. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2012]
Uniprot Description
RAB3IL1: Guanine nucleotide exchange factor (GEF) for Rab3A, a GTPase that regulates synaptic vesicle exocytosis. Belongs to the SEC2 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: GEFs, Rab; GEFs
Chromosomal Location of Human Ortholog: 11q12.2
Molecular Function: protein binding; Rab guanyl-nucleotide exchange factor activity
Research Articles on RAB3IL1
Similar Products
Product Notes
The RAB3IL1 rab3il1 (Catalog #AAA1278653) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggagcg gcccacccca gccagaccag ggcctcccgc cgccccttgc agctgtcccg gtcccctgga agagcacgga cccctgccaa ggccacaggg agtccccagg agccctggtg gagacctctg caggggagga ggcccaaggc caggagggcc ccgcagccgc ccagctggac gtgttgcgcc tgcgcagctc ttccatggag atccgagaga agggctccga gttcctgaag gaggagctgc acagagcgca gaaggagctg aagctaaagg acgaggaatg tgagcggctg tccaaggtgc gggagcagct agaacaggag ctggaagagc tgacggccag cctgtttgag gaagctcaca agatggttcg agaagccaac atgaagcagg cggcatcaga aaagcagctg aaggaggctc ggggcaagat cgacatgctg caggcagagg tgacagcctt gaagacactg gtcatcacgt ccacaccagc ctctcccaac cgcgagcttc acccccagct gctgagcccc accaaggccg ggccccgaaa gggccactct cgccacaaga gcaccagcag caccctctgc cccgccgtgt gtcccgctgc gggacacacc ctcaccccag acagagaggg caaggaggtg gacacaatcc tgtttgcaga gttccaggcc tggagggaat cccccaccct ggacaagacc tgccccttcc tggaaagggt gtaccgagag gacgtgggcc cctgcctgga cttcacaatg caggagctct cggtgctggt acgggccgcc gtggaggaca acacgctcac cattgagccg gtggcttcgc agacgctgcc cacagtgaag gtggccgagg ttgactgtag cagcaccaac acatgtgccc tgagcgggct gacccgcacc tgccgccacc gaatccggct cggggactcc aaaagccatt actacatctc gccatcttcc cgggccagga tcaccgcagt gtgcaacttc ttcacctaca tccgctacat ccagcaaggc ctggtgcggc aggacgcaga gcccatgttc tgggagatca tgaggttgcg gaaggagatg tcactggcca agctcggctt cttcccccag gaggcttag. It is sometimes possible for the material contained within the vial of "RAB3IL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
