Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJB1 cdna clone

DNAJB1 cDNA Clone

Gene Names
DNAJB1; Hdj1; Sis1; HSPF1; Hsp40; RSPH16B
Synonyms
DNAJB1; DNAJB1 cDNA Clone; DNAJB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtaaagactactaccagacgttgggcctggcccgcggcgcgtcggacgaggagatcaagcgggcctaccgccgccaggcgctgcgctaccacccggacaagaacaaggagcccggcgccgaggagaagttcaaggagatcgctgaggcctacgacgtgctcagcgacccgcgcaagcgcgagatcttcgaccgctacggggaggaaggcctaaaggggagtggccccagtggcggtagcggcggtggtgccaatggtacctctttcagctacacattccatggagaccctcatgccatgtttgctgagttcttcggtggcagaaatccctttgacaccttttttgggcagcggaacggggaggaaggcatggacattgatgacccattctctggcttccctatgggcatgggtggcttcaccaacgtgaactttggccgctcccgctctgcccaagagcccgcccgaaagaagcaagatcccccagtcacccacgaccttcgagtctcccttgaagagatctacagcggctgtaccaagaagatgaaaatctcccacaagcggctaaaccccgacggaaagagcattcgaaacgaagacaaaatattgaccatcgaagtgaagaaggggtggaaagaaggaaccaaaatcactttccccaaggaaggagaccagacctccaacaacattccagctgatatcgtctttgttttaaaggacaagccccacaatatctttaagagagatggctctgatgtcatttatcctgccaggatcagcctccgggaggctctgtgtggctgcacagtgaacgtccccactctggacggcaggacgatacccgtcgtattcaaagatgttatcaggcctggcatgcggcgaaaagttcctggagaaggcctccccctccccaaaacacccgagaaacgtggggacctcattattgagtttgaagtgatcttccccgaaaggattccccagacatcaagaaccgtacttgagcaggttcttccaatatag
Sequence Length
1023
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,016 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 1, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B1
NCBI Official Symbol
DNAJB1
NCBI Official Synonym Symbols
Hdj1; Sis1; HSPF1; Hsp40; RSPH16B
NCBI Protein Information
dnaJ homolog subfamily B member 1
UniProt Protein Name
DnaJ homolog subfamily B member 1
Protein Family
UniProt Gene Name
DNAJB1
UniProt Synonym Gene Names
DNAJ1; HDJ1; HSPF1; HSP40; Heat shock protein 40; hDj-1
UniProt Entry Name
DNJB1_HUMAN

NCBI Description

This gene encodes a member of the DnaJ or Hsp40 (heat shock protein 40 kD) family of proteins. DNAJ family members are characterized by a highly conserved amino acid stretch called the 'J-domain' and function as one of the two major classes of molecular chaperones involved in a wide range of cellular events, such as protein folding and oligomeric protein complex assembly. The encoded protein is a molecular chaperone that stimulates the ATPase activity of Hsp70 heat-shock proteins in order to promote protein folding and prevent misfolded protein aggregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Uniprot Description

Interacts with HSP70 and can stimulate its ATPase activity. Stimulates the association between HSC70 and HIP.

Research Articles on DNAJB1

Similar Products

Product Notes

The DNAJB1 dnajb1 (Catalog #AAA1278569) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtaaag actactacca gacgttgggc ctggcccgcg gcgcgtcgga cgaggagatc aagcgggcct accgccgcca ggcgctgcgc taccacccgg acaagaacaa ggagcccggc gccgaggaga agttcaagga gatcgctgag gcctacgacg tgctcagcga cccgcgcaag cgcgagatct tcgaccgcta cggggaggaa ggcctaaagg ggagtggccc cagtggcggt agcggcggtg gtgccaatgg tacctctttc agctacacat tccatggaga ccctcatgcc atgtttgctg agttcttcgg tggcagaaat ccctttgaca ccttttttgg gcagcggaac ggggaggaag gcatggacat tgatgaccca ttctctggct tccctatggg catgggtggc ttcaccaacg tgaactttgg ccgctcccgc tctgcccaag agcccgcccg aaagaagcaa gatcccccag tcacccacga ccttcgagtc tcccttgaag agatctacag cggctgtacc aagaagatga aaatctccca caagcggcta aaccccgacg gaaagagcat tcgaaacgaa gacaaaatat tgaccatcga agtgaagaag gggtggaaag aaggaaccaa aatcactttc cccaaggaag gagaccagac ctccaacaac attccagctg atatcgtctt tgttttaaag gacaagcccc acaatatctt taagagagat ggctctgatg tcatttatcc tgccaggatc agcctccggg aggctctgtg tggctgcaca gtgaacgtcc ccactctgga cggcaggacg atacccgtcg tattcaaaga tgttatcagg cctggcatgc ggcgaaaagt tcctggagaa ggcctccccc tccccaaaac acccgagaaa cgtggggacc tcattattga gtttgaagtg atcttccccg aaaggattcc ccagacatca agaaccgtac ttgagcaggt tcttccaata tag. It is sometimes possible for the material contained within the vial of "DNAJB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.