Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LGALS1 cdna clone

LGALS1 cDNA Clone

Gene Names
LGALS1; GBP; GAL1
Synonyms
LGALS1; LGALS1 cDNA Clone; LGALS1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttgtggtctggtcgccagcaacctgaatctcaaacctggagagtgccttcgagtgcgaggcgaggtggctcctgacgctaagagcttcgtgctgaacctgggcaaagacagcaacaacctgtgcctgcacttcaaccctcgcttcaacgcccacggcgacgccaacaccatcgtgtgcaacagcaaggacggcggggcctgggggaccgagcagcgggaggctgtctttcccttccagcctggaagtgttgcagaggtgtgcatcaccttcgaccaggccaacctgaccgtcaagctgccagatggatacgaattcaagttccccaaccgcctcaacctggaggccatcaactacatggcagctgacggtgacttcaagatcaaatgtgtggcctttgactga
Sequence Length
408
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,716 Da
NCBI Official Full Name
Homo sapiens lectin, galactoside-binding, soluble, 1, mRNA
NCBI Official Synonym Full Names
galectin 1
NCBI Official Symbol
LGALS1
NCBI Official Synonym Symbols
GBP; GAL1
NCBI Protein Information
galectin-1
UniProt Protein Name
Galectin-1
UniProt Gene Name
LGALS1
UniProt Synonym Gene Names
Gal-1; HLBP14
UniProt Entry Name
LEG1_HUMAN

NCBI Description

The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]

Uniprot Description

galectin-1: May regulate apoptosis, cell proliferation and cell differentiation. Binds beta-galactoside and a wide array of complex carbohydrates. Inhibits CD45 protein phosphatase activity and therefore the dephosphorylation of Lyn kinase. Homodimer. Binds LGALS3BP. Interacts with CD2, CD3, CD4, CD7, CD43 and CD45. Interacts with laminin (via poly-N- acetyllactosamine). Expressed in placenta, maternal decidua and fetal membranes. Within placenta, expressed in trophoblasts, stromal cells, villous endothelium, syncytiotrophoblast apical membrane and villous stroma. Within fetal membranes, expressed in amnion, chorioamniotic mesenchyma and chorion. Expressed in cardiac, smooth, and skeletal muscle, neurons, thymus, kidney and hematopoietic cells.

Protein type: Secreted; Extracellular matrix; Cell adhesion

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytoplasm; extracellular matrix; extracellular space; intracellular

Molecular Function: protein binding; signal transducer activity

Biological Process: positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of virion penetration into host cell; regulation of apoptosis

Research Articles on LGALS1

Similar Products

Product Notes

The LGALS1 lgals1 (Catalog #AAA1278528) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttgtg gtctggtcgc cagcaacctg aatctcaaac ctggagagtg ccttcgagtg cgaggcgagg tggctcctga cgctaagagc ttcgtgctga acctgggcaa agacagcaac aacctgtgcc tgcacttcaa ccctcgcttc aacgcccacg gcgacgccaa caccatcgtg tgcaacagca aggacggcgg ggcctggggg accgagcagc gggaggctgt ctttcccttc cagcctggaa gtgttgcaga ggtgtgcatc accttcgacc aggccaacct gaccgtcaag ctgccagatg gatacgaatt caagttcccc aaccgcctca acctggaggc catcaactac atggcagctg acggtgactt caagatcaaa tgtgtggcct ttgactga. It is sometimes possible for the material contained within the vial of "LGALS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.