Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GORASP1 cdna clone

GORASP1 cDNA Clone

Gene Names
GORASP1; P65; GOLPH5; GRASP65
Synonyms
GORASP1; GORASP1 cDNA Clone; GORASP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcctgggcgtcagcgctgagcagcccgcaggcggcgccgagggcttccacctccacggggtgcaggagaactccccagcccagcaggcgggcctggagccctactttgacttcatcatcaccattgggcactcgaggctgaacaaggagaatgacaccctgaaggcactactgaaagccaatgtggagaagcccgtgaagctggaggtgttcaatatgaagaccatgagggtgcgcgaggtggaggtggtgcccagcaacatgtggggcggccagggcctactgggtgccagtgtgcgcttctgcagcttccgcagggccagtgagcaggtgtggcatgtgctggatgtggaaccatcttcacctgctgcccttgccggcctgcgcccctacacagactatgtggttggttcggaccagattctccaggagtccgaggacttctttacgctcatcgagtctcatgaggggaagcccttgaagctgatggtgtataactccaagtcagactcctgccgggaggtgactgtaactcccaacgcagcctggggtggagagggcagtctgggatgtggcattggctatgggtatctacaccggatcccaactcagccccccagctaccacaagaagccacctggcaccccaccaccttctgctctaccacttggtgccccaccacctgatgctctaccacctggacccacccccgaggactctccttccctggagacaggttccaggcagagtgactacatggaggccctgctgcaggcacctggctcctccatggaggatccccttcctgggcctgggagtcccagccacagtgctccagaccctgatggacttccccatttcatggagactcctcttcagcccccacctccagtgcagcgagttatggacccaggcttcctggacgtgtcgggaatttctctcttggacaacagcaatgccagtgtgtggcccagcctgccctcttccacagaactgaccaccacagctgtctcaacctcagggccagaggacatctgctccagcagcagttctcatgagcggggtggtgaggctacatggtctgggtcagagtttgaggtctccttcctggacagcccaggtgcccaagcccaggcggaccacctgcctcagctgactcttcctgacagtctcacctctgcagcctcaccagaagatgggctgtccgccgagctgcttgaagctcaggctgaggaggaaccagcaagcacagagggcctagatactgggacggaggctgaggggctggacagccaggcccagatctctaccacagaataa
Sequence Length
1323
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,237 Da
NCBI Official Full Name
Homo sapiens golgi reassembly stacking protein 1, 65kDa, mRNA
NCBI Official Synonym Full Names
golgi reassembly stacking protein 1
NCBI Official Symbol
GORASP1
NCBI Official Synonym Symbols
P65; GOLPH5; GRASP65
NCBI Protein Information
Golgi reassembly-stacking protein 1
UniProt Protein Name
Golgi reassembly-stacking protein 1
UniProt Gene Name
GORASP1
UniProt Synonym Gene Names
GOLPH5; GRASP65; GOLPH5; GRASP65
UniProt Entry Name
GORS1_HUMAN

NCBI Description

The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a membrane protein involved in establishing the stacked structure of the Golgi apparatus. It is a caspase-3 substrate, and cleavage of this encoded protein contributes to Golgi fragmentation in apoptosis. This encoded protein can form a complex with the Golgi matrix protein GOLGA2, and this complex binds to the vesicle docking protein p115. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]

Uniprot Description

GRASP65: Stacking factor involved in the postmitotic assembly of Golgi stacks from mitotic Golgi fragments. Key structural protein required for the maintenance of the Golgi apparatus integrity: its caspase-mediated cleavage is required for fragmentation of the Golgi during apoptosis. Also mediates, via its interaction with GM130, the docking of transport vesicles with the Golgi membranes. Belongs to the GORASP family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 3p22-p21.33

Cellular Component: ER-Golgi intermediate compartment membrane; Golgi apparatus; Golgi membrane

Molecular Function: protein binding

Biological Process: COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; Golgi organization and biogenesis; negative regulation of dendrite morphogenesis

Research Articles on GORASP1

Similar Products

Product Notes

The GORASP1 gorasp1 (Catalog #AAA1278429) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcctgg gcgtcagcgc tgagcagccc gcaggcggcg ccgagggctt ccacctccac ggggtgcagg agaactcccc agcccagcag gcgggcctgg agccctactt tgacttcatc atcaccattg ggcactcgag gctgaacaag gagaatgaca ccctgaaggc actactgaaa gccaatgtgg agaagcccgt gaagctggag gtgttcaata tgaagaccat gagggtgcgc gaggtggagg tggtgcccag caacatgtgg ggcggccagg gcctactggg tgccagtgtg cgcttctgca gcttccgcag ggccagtgag caggtgtggc atgtgctgga tgtggaacca tcttcacctg ctgcccttgc cggcctgcgc ccctacacag actatgtggt tggttcggac cagattctcc aggagtccga ggacttcttt acgctcatcg agtctcatga ggggaagccc ttgaagctga tggtgtataa ctccaagtca gactcctgcc gggaggtgac tgtaactccc aacgcagcct ggggtggaga gggcagtctg ggatgtggca ttggctatgg gtatctacac cggatcccaa ctcagccccc cagctaccac aagaagccac ctggcacccc accaccttct gctctaccac ttggtgcccc accacctgat gctctaccac ctggacccac ccccgaggac tctccttccc tggagacagg ttccaggcag agtgactaca tggaggccct gctgcaggca cctggctcct ccatggagga tccccttcct gggcctggga gtcccagcca cagtgctcca gaccctgatg gacttcccca tttcatggag actcctcttc agcccccacc tccagtgcag cgagttatgg acccaggctt cctggacgtg tcgggaattt ctctcttgga caacagcaat gccagtgtgt ggcccagcct gccctcttcc acagaactga ccaccacagc tgtctcaacc tcagggccag aggacatctg ctccagcagc agttctcatg agcggggtgg tgaggctaca tggtctgggt cagagtttga ggtctccttc ctggacagcc caggtgccca agcccaggcg gaccacctgc ctcagctgac tcttcctgac agtctcacct ctgcagcctc accagaagat gggctgtccg ccgagctgct tgaagctcag gctgaggagg aaccagcaag cacagagggc ctagatactg ggacggaggc tgaggggctg gacagccagg cccagatctc taccacagaa taa. It is sometimes possible for the material contained within the vial of "GORASP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.