METTL10 cdna clone
METTL10 cDNA Clone
Gene Names
METTL10; C10orf138
Synonyms
METTL10; METTL10 cDNA Clone; METTL10 cdna clone
Sequence
atgagctcgggcgctgacggcggcggtggcgctgcggtggcggcgcggtcggacaagggcagtcccggggaggacggtttcgtcccgtcggcgctggggacccgcgagcattgggatgctgtctatgagagagaactgcaaactttccgagaatatggagatacaggtgaaatctggtttggagaagagagtatgaatcgactaataaggtggatgcagaaacacaagattccactggatgcttcagtgcttgatattggaactggaaatggtgttttcctggttgaacttgcaaaatttggtttctctaatattactggaattgattactctccttctgcaattcagctttctggaagtattatagaaaaagaaggtttatctaacattaagttaaaggtagaagactttttgaatctctccacacagctgtctggatttcatatttgtattgacaaagggacttttgatgccataagccttaatcctgacaatgcaattgagaagaggaagcaatatgtgaaatctctctccagggtgttgaaagtaaaaggctttttttctaataacgtcatgtaa
Sequence Length
579
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,830 Da
NCBI Official Full Name
Homo sapiens methyltransferase like 10, mRNA
NCBI Official Synonym Full Names
methyltransferase like 10
NCBI Official Symbol
METTL10
NCBI Official Synonym Symbols
C10orf138
NCBI Protein Information
protein-lysine N-methyltransferase METTL10
UniProt Protein Name
Protein-lysine N-methyltransferase METTL10
Protein Family
UniProt Gene Name
METTL10
UniProt Entry Name
MET10_HUMAN
Uniprot Description
METTL10: Belongs to the methyltransferase superfamily.
Protein type: EC 2.1.1.-; Methyltransferase, protein arginine; Methyltransferase
Chromosomal Location of Human Ortholog: 10q26.13
Research Articles on METTL10
Similar Products
Product Notes
The METTL10 mettl10 (Catalog #AAA1278373) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctcgg gcgctgacgg cggcggtggc gctgcggtgg cggcgcggtc ggacaagggc agtcccgggg aggacggttt cgtcccgtcg gcgctgggga cccgcgagca ttgggatgct gtctatgaga gagaactgca aactttccga gaatatggag atacaggtga aatctggttt ggagaagaga gtatgaatcg actaataagg tggatgcaga aacacaagat tccactggat gcttcagtgc ttgatattgg aactggaaat ggtgttttcc tggttgaact tgcaaaattt ggtttctcta atattactgg aattgattac tctccttctg caattcagct ttctggaagt attatagaaa aagaaggttt atctaacatt aagttaaagg tagaagactt tttgaatctc tccacacagc tgtctggatt tcatatttgt attgacaaag ggacttttga tgccataagc cttaatcctg acaatgcaat tgagaagagg aagcaatatg tgaaatctct ctccagggtg ttgaaagtaa aaggcttttt ttctaataac gtcatgtaa. It is sometimes possible for the material contained within the vial of "METTL10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
