Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MUL1 cdna clone

MUL1 cDNA Clone

Gene Names
MUL1; GIDE; MAPL; MULAN; RNF218; C1orf166
Synonyms
MUL1; MUL1 cDNA Clone; MUL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagagcggagggcggccctcgctgtgccagttcatcctcctgggcaccacctctgtggtcaccgccgccctgtactccgtgtaccggcagaaggcccgggtctcccaagagctcaagggagctaaaaaagttcatttgggtgaagatttaaagagtattctttcagaagctccaggaaaatgcgtgccttatgctgttatagaaggagctgtgcggtctgttaaagaaacgcttaacagccagtttgtggaaaactgcaagggggtaattcagcggctgacacttcaggagcacaagatggtgtggaatcgaaccacccacctttggaatgattgctcaaagatcattcatcagaggaccaacacagtgccctttgacctggtgccccacgaggatggcgtggatgtggctgtgcgagtgctgaagcccctggactcagtggatctgggtctagagactgtgtatgagaagttccacccctcgattcagtccttcaccgatgtcatcggccactacatcagcggtgagcggcccaaaggcatccaagagaccgaggagatgctgaaggtgggggccaccctcacaggggttggcgaactggtcctggacaacaactctgtccgcctgcagccgcccaaacaaggcatgcagtactatctaagcagccaggacttcgacagcctgctgcagaggcaggagtcgagcgtcaggctctggaaggtgctggcgctggtttttggctttgccacatgtgccaccctcttcttcattctccggaagcagtatctgcagcggcaggagcgcctgcgcctcaagcagatgcaggaggagttccaggagcatgaggcccagctgctgagccgagccaagcctgaggacagggagagtctgaagagcgcctgtgtagtgtgtctgagcagcttcaagtcctgcgtctttctggagtgtgggcacgtttgttcctgcaccgagtgctaccgcgccttgccagagcccaagaagtgccctatctgcagacaggcgatcacccgggtgatacccctgtacaacagctaa
Sequence Length
1059
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,800 Da
NCBI Official Full Name
Homo sapiens mitochondrial E3 ubiquitin ligase 1, mRNA
NCBI Official Synonym Full Names
mitochondrial E3 ubiquitin protein ligase 1
NCBI Official Symbol
MUL1
NCBI Official Synonym Symbols
GIDE; MAPL; MULAN; RNF218; C1orf166
NCBI Protein Information
mitochondrial ubiquitin ligase activator of NFKB 1
UniProt Protein Name
Mitochondrial ubiquitin ligase activator of NFKB 1
UniProt Gene Name
MUL1
UniProt Synonym Gene Names
C1orf166; GIDE; MAPL; MULAN; RNF218; MAPL
UniProt Entry Name
MUL1_HUMAN

Uniprot Description

MULAN: Exhibits weak E3 ubiquitin-protein ligase activity, but preferentially acts as a SUMO E3 ligase at physiological concentrations. Plays a role in the control of mitochondrial morphology. Promotes mitochondrial fragmentation and influences mitochondrial localization. Inhibits cell growth. When overexpressed, activates JNK through MAP3K7/TAK1 and induces caspase-dependent apoptosis. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfer the ubiquitin to targeted substrates.

Protein type: EC 6.3.2.19; Ubiquitin ligase; Apoptosis; Membrane protein, multi-pass; EC 6.3.2.-; Ubiquitin conjugating system; Ligase; Mitochondrial; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p36.12

Cellular Component: axon; cell soma; cytoplasm; integral to mitochondrial outer membrane; membrane; mitochondrion; nucleoplasm; peroxisome

Molecular Function: identical protein binding; protein binding; signal transducer activity; SUMO ligase activity; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: activation of JNK activity; caspase activation; mitochondrial fission; mitochondrion localization; negative regulation of cell growth; negative regulation of defense response to virus by host; negative regulation of innate immune response; negative regulation of protein kinase B signaling cascade; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of protein sumoylation; protein destabilization; protein stabilization; protein ubiquitination

Research Articles on MUL1

Similar Products

Product Notes

The MUL1 mul1 (Catalog #AAA1278356) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagcg gagggcggcc ctcgctgtgc cagttcatcc tcctgggcac cacctctgtg gtcaccgccg ccctgtactc cgtgtaccgg cagaaggccc gggtctccca agagctcaag ggagctaaaa aagttcattt gggtgaagat ttaaagagta ttctttcaga agctccagga aaatgcgtgc cttatgctgt tatagaagga gctgtgcggt ctgttaaaga aacgcttaac agccagtttg tggaaaactg caagggggta attcagcggc tgacacttca ggagcacaag atggtgtgga atcgaaccac ccacctttgg aatgattgct caaagatcat tcatcagagg accaacacag tgccctttga cctggtgccc cacgaggatg gcgtggatgt ggctgtgcga gtgctgaagc ccctggactc agtggatctg ggtctagaga ctgtgtatga gaagttccac ccctcgattc agtccttcac cgatgtcatc ggccactaca tcagcggtga gcggcccaaa ggcatccaag agaccgagga gatgctgaag gtgggggcca ccctcacagg ggttggcgaa ctggtcctgg acaacaactc tgtccgcctg cagccgccca aacaaggcat gcagtactat ctaagcagcc aggacttcga cagcctgctg cagaggcagg agtcgagcgt caggctctgg aaggtgctgg cgctggtttt tggctttgcc acatgtgcca ccctcttctt cattctccgg aagcagtatc tgcagcggca ggagcgcctg cgcctcaagc agatgcagga ggagttccag gagcatgagg cccagctgct gagccgagcc aagcctgagg acagggagag tctgaagagc gcctgtgtag tgtgtctgag cagcttcaag tcctgcgtct ttctggagtg tgggcacgtt tgttcctgca ccgagtgcta ccgcgccttg ccagagccca agaagtgccc tatctgcaga caggcgatca cccgggtgat acccctgtac aacagctaa. It is sometimes possible for the material contained within the vial of "MUL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.