Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFT80 cdna clone

IFT80 cDNA Clone

Gene Names
IFT80; ATD2; SRTD2; WDR56
Synonyms
IFT80; IFT80 cDNA Clone; IFT80 cdna clone
Ordering
For Research Use Only!
Sequence
atgagactaaagatatctcttttaaaagaaccaaagcatcaagaattagtaagctgtgtgggctggactactgctgaagagctgtattcatgtagtgatgatcaccagatagtgaagtggaacttgttaaccagtgaaacaactcaaatagtaaagcttcctgatgatatttaccctattgattttcactggtttccaaaaagtttgggtgtaaagaaacaaacccaggcagaaagctttgtcctcacaagttctgatggtaaatttcatctgatttccaagttaggaagagtggaaaaaagtgtagaagctcactgtggagcagtacttgcaggaagatggaattatgaaggaacagcattagttacagttggagaagatggacaaataaaaatttggtcaaagactgggatgcttagatcaactttagctcagcaaggaacaccagtgtattcagtagcgtggggccctgattcagaaaaggttctttatacagcaggcaagcagctaatcattaaacctcttcaaccaaatgctaaagttttgcagtggaaagctcatgatggcattattttaaaagtagattggaactcggtcaatgatcttattttatctgctggtgaagactgtaaatataaggtatgggatagttacggccgcccactgtacaattcacaacctcatgagcatcccattacttcagttgcctgggctccagatggagaattatttgctgttggatcgtttcatactttacgcttgtgtgataaaactgggtggtcatatgcattagaaaaacccaacactggcagcatatttaatattgcatggtctatcgatggcactcagattgctggagcctgtggaaatggacatgtcgtttttgcacatgtggtggaacaacattgggagtggaaaaattttcaagtaacattaacgaaaagaagagccatgcaggttcgtaatgttcttaatgatgcagtggatttactggaattccgtgatagagtcattaaagcatctttgaactatgcacacttagttgtttcaacgtctcttcaatgttacgtgttctccacgaagaactggaacacaccaattatatttgatctcaaagaaggaactgttagtttgattctgcaggcagaaagacattttcttcttgtagatggtagtagtatctatttatattcatatgaagggcgctttatttcatctccaaaatttcctggaatgagaacagatattctgaatgcacagactgtgtctttgagtaatgataccatagcaataagagacaaagctgatgaaaaaataatcttcctctttgaggcatcaaccggaaagccgttaggtgatggaaagtttctttctcataagaatgaaatcttggaaattgctctggatcaaaaaggacttaccaatgatagaaaaattgctttcattgataaaaatagagatctctgtatcacttctgtgaaacgatttgggaaggaagaacaaattatcaagcttggaacaatggtgcatactttggcatggaacgatacatgcaatatcctttgtggacttcaagatactcgatttatagtgtggtattaccccaatacagtttatgtggacagagacattttgcctaaaacattatatgaaagggatgcaagtgaatttagtaaaaatccccatattgtgagttttgttggaaatcaagtaactattagaagagctgatggctccctggttcacatcagcataacaccatatcctgctattctccatgaatatgtaagcagttcaaaatgggaagatgctgtgagactttgtcgctttgttaaggagcaaaccatgtgggcttgtctagctgctatggcagttgctaatcgagatatgactactgcagaaatagcctatgcagcaattggtgaaattgataaggttcagtacatcaattctataaaaaatcttccatctaaagaatcaaaaatggcccacatactactgtttagtgggaacatacaggaggctgaaatagtacttcttcaggctggccttgtttatcaagcaatccagatcaatattaatctctacaactgggaaagggcactggaattggctgtaaaatacaaaacacatgttgatacagttcttgcttaccgtcaaaagtttttggagacatttggtaaacaggaaactaataaacgatacttgcattatgcagaaggtctccaaatagattgggagaaaatcaaagccaaaattgagatggaaattacaaaagaaagagagcaatcatcaagcagccaatccagcaagagtataggtttaaagccctaa
Sequence Length
2334
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
123,321 Da
NCBI Official Full Name
Homo sapiens intraflagellar transport 80 homolog (Chlamydomonas), mRNA
NCBI Official Synonym Full Names
intraflagellar transport 80
NCBI Official Symbol
IFT80
NCBI Official Synonym Symbols
ATD2; SRTD2; WDR56
NCBI Protein Information
intraflagellar transport protein 80 homolog
UniProt Protein Name
Intraflagellar transport protein 80 homolog
UniProt Gene Name
IFT80
UniProt Synonym Gene Names
KIAA1374; WDR56
UniProt Entry Name
IFT80_HUMAN

NCBI Description

The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]

Uniprot Description

IFT80: Component of the intraflagellar transport (IFT) complex B, which is essential for the development and maintenance of motile and sensory cilia. Defects in IFT80 are the cause of asphyxiating thoracic dystrophy type 2 (ATD2). An autosomal recessive chondrodysplasia characterized by a severely constricted thoracic cage, short-limbed short stature, and polydactyly. It often leads to death in infancy because of respiratory insufficiency. Retinal degeneration, cystic renal disease and hepatic disease can be present in affected individuals who survive early childhood.

Chromosomal Location of Human Ortholog: 3q25.33

Cellular Component: centrosome; cilium

Biological Process: cilium biogenesis

Disease: Short-rib Thoracic Dysplasia 2 With Or Without Polydactyly

Research Articles on IFT80

Similar Products

Product Notes

The IFT80 ift80 (Catalog #AAA1278308) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagactaa agatatctct tttaaaagaa ccaaagcatc aagaattagt aagctgtgtg ggctggacta ctgctgaaga gctgtattca tgtagtgatg atcaccagat agtgaagtgg aacttgttaa ccagtgaaac aactcaaata gtaaagcttc ctgatgatat ttaccctatt gattttcact ggtttccaaa aagtttgggt gtaaagaaac aaacccaggc agaaagcttt gtcctcacaa gttctgatgg taaatttcat ctgatttcca agttaggaag agtggaaaaa agtgtagaag ctcactgtgg agcagtactt gcaggaagat ggaattatga aggaacagca ttagttacag ttggagaaga tggacaaata aaaatttggt caaagactgg gatgcttaga tcaactttag ctcagcaagg aacaccagtg tattcagtag cgtggggccc tgattcagaa aaggttcttt atacagcagg caagcagcta atcattaaac ctcttcaacc aaatgctaaa gttttgcagt ggaaagctca tgatggcatt attttaaaag tagattggaa ctcggtcaat gatcttattt tatctgctgg tgaagactgt aaatataagg tatgggatag ttacggccgc ccactgtaca attcacaacc tcatgagcat cccattactt cagttgcctg ggctccagat ggagaattat ttgctgttgg atcgtttcat actttacgct tgtgtgataa aactgggtgg tcatatgcat tagaaaaacc caacactggc agcatattta atattgcatg gtctatcgat ggcactcaga ttgctggagc ctgtggaaat ggacatgtcg tttttgcaca tgtggtggaa caacattggg agtggaaaaa ttttcaagta acattaacga aaagaagagc catgcaggtt cgtaatgttc ttaatgatgc agtggattta ctggaattcc gtgatagagt cattaaagca tctttgaact atgcacactt agttgtttca acgtctcttc aatgttacgt gttctccacg aagaactgga acacaccaat tatatttgat ctcaaagaag gaactgttag tttgattctg caggcagaaa gacattttct tcttgtagat ggtagtagta tctatttata ttcatatgaa gggcgcttta tttcatctcc aaaatttcct ggaatgagaa cagatattct gaatgcacag actgtgtctt tgagtaatga taccatagca ataagagaca aagctgatga aaaaataatc ttcctctttg aggcatcaac cggaaagccg ttaggtgatg gaaagtttct ttctcataag aatgaaatct tggaaattgc tctggatcaa aaaggactta ccaatgatag aaaaattgct ttcattgata aaaatagaga tctctgtatc acttctgtga aacgatttgg gaaggaagaa caaattatca agcttggaac aatggtgcat actttggcat ggaacgatac atgcaatatc ctttgtggac ttcaagatac tcgatttata gtgtggtatt accccaatac agtttatgtg gacagagaca ttttgcctaa aacattatat gaaagggatg caagtgaatt tagtaaaaat ccccatattg tgagttttgt tggaaatcaa gtaactatta gaagagctga tggctccctg gttcacatca gcataacacc atatcctgct attctccatg aatatgtaag cagttcaaaa tgggaagatg ctgtgagact ttgtcgcttt gttaaggagc aaaccatgtg ggcttgtcta gctgctatgg cagttgctaa tcgagatatg actactgcag aaatagccta tgcagcaatt ggtgaaattg ataaggttca gtacatcaat tctataaaaa atcttccatc taaagaatca aaaatggccc acatactact gtttagtggg aacatacagg aggctgaaat agtacttctt caggctggcc ttgtttatca agcaatccag atcaatatta atctctacaa ctgggaaagg gcactggaat tggctgtaaa atacaaaaca catgttgata cagttcttgc ttaccgtcaa aagtttttgg agacatttgg taaacaggaa actaataaac gatacttgca ttatgcagaa ggtctccaaa tagattggga gaaaatcaaa gccaaaattg agatggaaat tacaaaagaa agagagcaat catcaagcag ccaatccagc aagagtatag gtttaaagcc ctaa. It is sometimes possible for the material contained within the vial of "IFT80, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.