Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FN3KRP cdna clone

FN3KRP cDNA Clone

Gene Names
FN3KRP; FN3KL
Synonyms
FN3KRP; FN3KRP cDNA Clone; FN3KRP cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagctgctgaggcgcgagctgggctgcagctctgtcagggccacgggccactcggggggcgggtgcatcagccagggccggagctacgacacggatcaaggacgagtgttcgtgaaagtgaaccccaaggcggaggccagaagaatgtttgaaggtgagatggcaagtttaactgccatcctgaaaacaaacacggtgaaagtgcccaagcccatcaaggttctggatgccccaggcggcgggagcgtgctggtgatggagcacatggacatgaggcatctgagcagtcatgctgcaaagcttggagcccagctggccgatttacaccttgataacaagaagcttggagagatgcgcctgaaggaggcgggcacagtggggagaggaggtgggcaggaggaacggccctttgtggcccggtttggatttgacgtggtgacgtgctgtggatacctcccccaggtgaatgactggcaggaggactgggtcgtgttctatgcccggcagcgcattcagccccagatggacatggtggagaaggagtctggggacagggaggccctccagctttggtctgctctgcagttaaagatccctgacctgttccgtgacctggagatcatcccagccttactccacggggacctctggggtggaaacgtagcagaggattcctctgggccggtgatttttgacccagcttctttctacggccactcggaatatgagctggcaatagctggcatgtttgggggctttagcagctccttttactccgcctaccacggcaaaatccccaaggccccaggattcgagaagcgccttcagttgtatcagctctttcactacttgaaccactggaatcattttggatcggggtacagaggatcctccctgaacatcatgaggaatctggtcaagtga
Sequence Length
930
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,412 Da
NCBI Official Full Name
Homo sapiens fructosamine 3 kinase related protein, mRNA
NCBI Official Synonym Full Names
fructosamine 3 kinase related protein
NCBI Official Symbol
FN3KRP
NCBI Official Synonym Symbols
FN3KL
NCBI Protein Information
ketosamine-3-kinase
UniProt Protein Name
Ketosamine-3-kinase
Protein Family
UniProt Gene Name
FN3KRP
UniProt Synonym Gene Names
FN3K-RP; FN3K-related protein
UniProt Entry Name
KT3K_HUMAN

NCBI Description

A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of psicosamines and ribulosamines compared to the neighboring gene which encodes a highly similar enzyme, fructosamine-3-kinase, which has different substrate specificity. The activity of both enzymes may result in deglycation of proteins to restore their function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]

Uniprot Description

FN3KRP: Phosphorylates psicosamines and ribulosamines, but not fructosamines, on the third carbon of the sugar moiety. Protein- bound psicosamine 3-phosphates and ribulosamine 3-phosphates are unstable and decompose under physiological conditions. Thus phosphorylation leads to deglycation. Belongs to the fructosamine kinase family.

Protein type: EC 2.7.1.-; Kinase, other

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: cytosol

Molecular Function: kinase activity

Biological Process: post-translational protein modification

Research Articles on FN3KRP

Similar Products

Product Notes

The FN3KRP fn3krp (Catalog #AAA1278255) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagc tgctgaggcg cgagctgggc tgcagctctg tcagggccac gggccactcg gggggcgggt gcatcagcca gggccggagc tacgacacgg atcaaggacg agtgttcgtg aaagtgaacc ccaaggcgga ggccagaaga atgtttgaag gtgagatggc aagtttaact gccatcctga aaacaaacac ggtgaaagtg cccaagccca tcaaggttct ggatgcccca ggcggcggga gcgtgctggt gatggagcac atggacatga ggcatctgag cagtcatgct gcaaagcttg gagcccagct ggccgattta caccttgata acaagaagct tggagagatg cgcctgaagg aggcgggcac agtggggaga ggaggtgggc aggaggaacg gccctttgtg gcccggtttg gatttgacgt ggtgacgtgc tgtggatacc tcccccaggt gaatgactgg caggaggact gggtcgtgtt ctatgcccgg cagcgcattc agccccagat ggacatggtg gagaaggagt ctggggacag ggaggccctc cagctttggt ctgctctgca gttaaagatc cctgacctgt tccgtgacct ggagatcatc ccagccttac tccacgggga cctctggggt ggaaacgtag cagaggattc ctctgggccg gtgatttttg acccagcttc tttctacggc cactcggaat atgagctggc aatagctggc atgtttgggg gctttagcag ctccttttac tccgcctacc acggcaaaat ccccaaggcc ccaggattcg agaagcgcct tcagttgtat cagctctttc actacttgaa ccactggaat cattttggat cggggtacag aggatcctcc ctgaacatca tgaggaatct ggtcaagtga. It is sometimes possible for the material contained within the vial of "FN3KRP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.