Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HEXDC cdna clone

HEXDC cDNA Clone

Synonyms
HEXDC; HEXDC cDNA Clone; HEXDC cdna clone
Ordering
For Research Use Only!
Sequence
atggagtttgtgctgaagcacacggccttcgcccacctgcgggaggtgggctccttcccctgcaccctgaacccccacgaggcagagtccctggcgctggtgggcgccatgattgaccaggtcctggagctacacccaggcgcccagcggctgcacatcgggtgtgatgaggtctattacctcggagagggggaggcctcgcgccggtggctacagcaagagcagaacagcacggggaagttgtgcctgtcacacatgcgggcggtggccagcggcgtgaaggcccggcgccccagcgtgacacccctggtgtgggacgacatgctccgagacctgcctgaggaccagctcgcagcgtccggggtgccgcagctggtggagccggtgctctgggactacacggccgacctggatgtgtacggcaaggtcctcctcatgcagaagtaccggcggtgcggctttccgcagctgtgggcagccagtgccttcaagggtgccacggggcccagccaggccgtgccccctgttgagcaccacctcaggaaccacgtgcagtggctgcaggtggcgggcagcgggcccacggactcactgcagggcatcatcctgaccggctggcagaggtacgaccactactctgtgctgtgcgagctgctgcccgcaggagtcccgtccctggccgcctgcctgcagttgcttctacgcggaggatttgatgaagatgttaaagcgaaagtggagaaccttctcgggatttccagcctggaaaaaacggaccctgttaggcaagcaccctgcagccctccctgtccccttcttcccctccccttcccccgcccgtggagacagctgttctcagcagggctctccgcagggagggggccggctccttccctggcagcaacatccttgcccttgtcacacaagtcagcctccatctgcgcagctctgtggatgcgctgctggagggcaacaggtatgtcactggctggttcagcccctaccaccgccagcggaagctcatccacccggtcatggttcagcacatccagcccgcagcgctcagcctcctggcacagtggagcaccctcgtgcaggagctggaggctgccctgcagctggctttctacccggatgccgtggaggagtggctggaggaaaacgtgcaccccagcctgcagcggctgcaagctctgctgcaggacctcagcgaggtgtctgcccccccgctgccacccaccagccctggcagggacgttgctcaggacccctgaggggagagctcatgccagggggctcctgctggaggctgggggggctctgcactgccaaatggcctgggcaatacgggcccacgtgggcgtcgtgccctctggcccagcagtgtcttgcccacactcagttcctgagggccctgggcagcccctgggggagagactagaaaacacagaaggaagcagcacagggagacccgctttgtga
Sequence Length
1482
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,502 Da
NCBI Official Full Name
Homo sapiens hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing, mRNA
NCBI Official Synonym Full Names
hexosaminidase D
NCBI Official Symbol
HEXDC
NCBI Protein Information
hexosaminidase D
UniProt Protein Name
Hexosaminidase D
Protein Family
UniProt Gene Name
HEXDC
UniProt Entry Name
HEXDC_HUMAN

Uniprot Description

HEXDC: Has hexosaminidase activity. Belongs to the glycosyl hydrolase 20 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 3.2.1.52

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: cytoplasm

Molecular Function: hexosaminidase activity

Biological Process: carbohydrate metabolic process

Research Articles on HEXDC

Similar Products

Product Notes

The HEXDC hexdc (Catalog #AAA1278218) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtttg tgctgaagca cacggccttc gcccacctgc gggaggtggg ctccttcccc tgcaccctga acccccacga ggcagagtcc ctggcgctgg tgggcgccat gattgaccag gtcctggagc tacacccagg cgcccagcgg ctgcacatcg ggtgtgatga ggtctattac ctcggagagg gggaggcctc gcgccggtgg ctacagcaag agcagaacag cacggggaag ttgtgcctgt cacacatgcg ggcggtggcc agcggcgtga aggcccggcg ccccagcgtg acacccctgg tgtgggacga catgctccga gacctgcctg aggaccagct cgcagcgtcc ggggtgccgc agctggtgga gccggtgctc tgggactaca cggccgacct ggatgtgtac ggcaaggtcc tcctcatgca gaagtaccgg cggtgcggct ttccgcagct gtgggcagcc agtgccttca agggtgccac ggggcccagc caggccgtgc cccctgttga gcaccacctc aggaaccacg tgcagtggct gcaggtggcg ggcagcgggc ccacggactc actgcagggc atcatcctga ccggctggca gaggtacgac cactactctg tgctgtgcga gctgctgccc gcaggagtcc cgtccctggc cgcctgcctg cagttgcttc tacgcggagg atttgatgaa gatgttaaag cgaaagtgga gaaccttctc gggatttcca gcctggaaaa aacggaccct gttaggcaag caccctgcag ccctccctgt ccccttcttc ccctcccctt cccccgcccg tggagacagc tgttctcagc agggctctcc gcagggaggg ggccggctcc ttccctggca gcaacatcct tgcccttgtc acacaagtca gcctccatct gcgcagctct gtggatgcgc tgctggaggg caacaggtat gtcactggct ggttcagccc ctaccaccgc cagcggaagc tcatccaccc ggtcatggtt cagcacatcc agcccgcagc gctcagcctc ctggcacagt ggagcaccct cgtgcaggag ctggaggctg ccctgcagct ggctttctac ccggatgccg tggaggagtg gctggaggaa aacgtgcacc ccagcctgca gcggctgcaa gctctgctgc aggacctcag cgaggtgtct gcccccccgc tgccacccac cagccctggc agggacgttg ctcaggaccc ctgaggggag agctcatgcc agggggctcc tgctggaggc tgggggggct ctgcactgcc aaatggcctg ggcaatacgg gcccacgtgg gcgtcgtgcc ctctggccca gcagtgtctt gcccacactc agttcctgag ggccctgggc agcccctggg ggagagacta gaaaacacag aaggaagcag cacagggaga cccgctttgt ga. It is sometimes possible for the material contained within the vial of "HEXDC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.